Answer:
oxygen is moved across a membrane O, cause the others are untrue.
How can agriculture cause soil pollution?
Agriculture pollution
Explanation:
Agriculture is a main source of pollution in lake water. chemical and fertilzer
Answer:
Pesticides and fertilizers used on crops fed to animals are a major contributor to land pollution
Explanation:
hope this helps :)
Describe mechanism of blood circulation.
Answer:
Look down!! ;)
Explanation:
Blood comes into the right atrium from the body, moves into the right ventricle and is pushed into the pulmonary arteries in the lungs. After picking up oxygen, the blood travels back to the heart through the pulmonary veins into the left atrium, to the left ventricle and out to the body's tissues through the aorta.
Hope this helps!! ;)
4. Compare and Contrast Which kind of plant–a sun plant or a shade plant-has a
higher rate of photosynthesis when light intensity is below 200 umol photons/mº/s?
When light intensity is above 400 umol photons/mº/s?
Answer:
Below 200 umol photons/mº/s, shade plant grow best.
Above 400 umol photons/mº/s, sun plant grow best.
Explanation:
A shade plant has a higher rate of photosynthesis when light intensity is present below 200 umol photons/mº/s because shade plants needs low light intensity for higher photosynthesis while on the other hand, a sun plant has a higher rate of photosynthesis when light intensity is above 400 umol photons/mº/s because it requires high intensity of light for photosynthesis if other factors are also present in large amount such as water and nutrients in the soil.
Why is it important we reduce the amount of greenhouse gases we
put into the atmosphere?
Answer:
Mhm
Explanation:
Without any greenhouse gases, Earth would be an icy wasteland. Greenhouse gases keep our planet livable by holding onto some of Earth's heat energy so that it doesn't all escape into space. This heat trapping is known as the greenhouse effect. ... Putting so much new CO2 into the air has made Earth warmer.
Answer:
If we don't reduce the emissions of greenhouse gasses, we will end up have climate change. As the world heats up, the water levels rise, the polar ice caps melt and costal cities will end up under water at somepoint. Also animals that can't handle the temp changes can die.
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
When is carbon dioxide released during aerobic cellular respiration?
Answer:
I hope this helps and rate it if its right
Explanation:
I hope this helps and rate it if its right
In a meeting, the presiding officers would like to convince the group on the
importance of a certain mandate but the group seems too passive about it.
Answer: Brainstorming meeting
Explanation:
In the brainstorming meeting the agenda of the meeting is put forward. The diverse knowledge, skills, opinions, and background are valued in such meeting. The participants may have distinct opinions and it becomes uneasy to convince the group by the presiding officers. The group members can be passive about the mandate as they may have different perceptions and ideas to tackle a matter.
Florida's land ecosystems include___________________. Check ALL that apply. *
prairies
forests
beaches
dunes
estuaries
Answer:
dunes, beaches, and maybe estuaries
Explanation:
i hope thats right.....
Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work after he returned home from his voyage and studying the selective breeding of pigeons prompted him to ask which question?
A) Do living things change over time, and if so, how?
B) Are the Galapagos finches and those on the mainland the same species?
C) Are pigeons related to the Galapagos finches?
D) Can selection in nature also lead to a new species over time?
Answer: D. Can selection in nature also lead to a new species over time?
Explanation:
Answer:
Can selection in nature also lead to a new species over time?
Explanation:
Correct on edge 2021 hope this helps :)
Which type of reproduction is shown below
Answer:
ummm there is no reproduction shown below
2. What 3 smaller parts of the DNA molecule make up a nucleotide?
Answer:
nitrogenous base
a carbon-based sugar molecule called deoxyribose
a phosphorus-containing region known as a phosphate
Why are bananas curved?
Answer:
It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.
Explanation:
g.o.o.g.l.e lma o
Answer
It's because of the sun!
Explanation:
Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.
There is a belief that there are as many neurons in the human body as there are stars in the Milky Way Galaxy. Do you believe this? How would you react on this?
Answer:
I do believe this. If you take the amount of neurons in the average adult body and expand them to the size of a say a blueberry It would expand to be the approximately the size of the sun
Explanation:
The given statement is true. It is a surprising fact that helps a person to believe that his brain has the power to take him beyond expectations.
What are Neurons?These are the nerve cell that is found in the brain and nerve tissue in the body.It has been estimated that there are 100 billion neurons in the human brain which is about the number of stars in our Galaxy.The human brain is very complex and this complexity comes from such a huge number of neurons.
Therefore, the given statement is true. It is a surprising fact that helps a person to believe that his brain has the power to take him beyond expectations.
Learn more about the human brain:
https://brainly.com/question/1282105
Can someone please help me I don't understand the and my parents don't under please
432hz x 432hz = 2228
Explanation:
the simple explanation is shushh
Which best explains why DNA technology is important for disease prevention?
A: It can help detect if a person is prone to certain diseases.
B: It can manipulate genes to express desirable traits
C: It can treat diseases with the help of genetically modified food
D: It can increase the genetic diversity of a species.
Which factor can decrease the rate of a chemical reaction?
low activation energy
high pressure
low temperature
high concentration of enzyme
please help!! 15 points
Answer:
The answer is the age of the rock.
Explanation:
Scientists can use their tools and DNA to figure out the age of rocks.
Where in Nebraska was the oldest known species of horses found? *
Answer:
Knox County
Explanation:
i live in Nebraska
The oldest known species of horse found in Knox County in Nebraska, Eohippus, (genus Hyracotherium), also called dawn horse, is considered as oldest known species of horse, hence option 1 is correct.
What are the species of horses?The horse is a mammal considered a domesticated one-toed, hoofed mammal and belongs to the taxonomic family of Equus ferus, there is only one species of a domesticated horse but around 400 breeds developed for the improvement of their strength.
All horses are considered grazers, food like grasses and plants, and believed as herbivores in the tropic level, only plants not animals.
These animals generally use for domestication purposes by human beings for pulling carts and heavy materials.
Therefore, in Knox County of Nebraska, the oldest known species of horses is found, hence option 1 is correct.
Learn more about horses, here:
https://brainly.com/question/30348283
#SPJ2
The given question is incomplete, so the most probable complete question is,
Where in Nebraska was the oldest known species of horses found?
1: Knox County
2: United States
3: Grand Island
4: Omaha
Arrange these energy sources from highest to lowest percentage of worldwide use. 1, Nuclear 1. Coal * Hydroelectric
Explanation:
hydro coal nuclear i think it would like thst
The arrangement of the energy according to the highest to the lowest percentage of worldwide use is coal, hydroelectric and nuclear. The arrangement is 2, 3, and 1.
What is energy?Energy is a quantitative property that is used in doing any work. The energy is always transferred from one form to another form. It is present in the conserved form.
The energy which is used majorly is coal, then hydroelectricity, which is made by water then the nuclear power plant.
Thus, the arrangement is 2. Coal, 3, hydroelectric, 1. Nuclear energy.
Learn more about energy, here:
https://brainly.com/question/12396199
#SPJ2
submit this form. Not you? Switch account
* Required
3. How do the biotic factors in an ecosystem depend on the abiotic factors
Answer:
biotic factors depend on abiotic factors for survival
Explanation:
(Many points) PLS HELP QUICK dont guess answer pls ad dont say random answers for points pls
Cheng made a chart to list the functions of certain fish structures.
(The image below)
Which headings correctly complete the chart?
X: Fin
Y: Swim bladder
Z: Lateral line
X: Fin
Y: Lateral line
Z: Swim bladder
X: Lateral line
Y: Swim bladder
Z: Fin
X: Lateral Line
Y: Fin
Z: Swim bladder
Answer:
x:fin
y:lateral line
z:swim bladder
Answer: The answer for this question is Fin for x Lateral line for y and
swim bladder for z
Explanation:
I took the test
Summarize in 2-3 sentences, how an RNA vaccine works to help protect you against
viruses?
I
Answer:
boost your immune system
Explanation:
Answer:
Vaccination is the process in which substances called antigens are introduced artificially into the body to stimulate the immune system, the set of cells that protects the body against infections .
Which level of organization is formed when a group of organs work together to perform complex functions?
Molecule
Organ
Organ system
Tissue
Answer:
Organ system is the correct answer, i took the test and passed.
( trust me ;)
Explanation:
Please give me brainlyest
I hope this helps
( Please Subscribe to Yaya Playz 23 ) for a free shout out)
Answer: i think it is the 3rd one but i am not sure
Explanation: hope you pass the exam :)
FILL OUT THE BLANKS PLS!!
If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color:
Independent: _________
Dependent: __________
Other variable(s): ________
Answer:
If leaf color change is related to temperature, then exposing plants to low temperatures will result in changes in leaf color:
Independent: temperature.
Dependent: leaf color.
Other variable(s): According to the information, there are no other variables.
Explanation:
When formulating a hypothesis, it is inevitable that the presence of variables on which the hypothesis is formed is established. The hypothesis raised is the effect of temperature on the color change of the leaf of a plant.
The independent variable, used in research work, is an element that does not depend on other variables but can influence the behavior of the dependent variable. In this case, the independent variable is the temperature. In addition, the independent variable can be managed to observe its effect on other variables.
An dependent variable is a characteristic that is influenced or modified by the presence of other variables, such as the independent variable of a study. In this case is the color of the leaf of a plant.
hi PLSS HELPP
This is 15 points don’t scam
Answer:
Explanation:
Each time nucleotides are bound together, a water molecule is removed (or lost through a process called dehydration synthesis. Many molecules rely on dehydration synthesis to assist with forming polymers.
1.What is the adaptation that is beneficial to organisms in the Mountain Rock environment?
2.What is the adaptation that is beneficial to organisms in the Desert Sand environment?
Answer:
Dense hair and thick skin.
Thin skin and Nocturnal behavior.
Explanation:
Dense hair and thick skin are the adaptation that is beneficial to organisms that is present in the environmental condition of Mountain Rock because on Mountain Rock, the temperature is very low so organisms needs something which make them warm, while on the other hand, thin skin and Nocturnal behavior are the adaptations that is beneficial to organisms in the Desert Sand environment because temperature is very hot.
Explain how a mutation has caused the Lactase Persistence gene in some people and not in others.
Answer:
It is a case of human niche construction
Explanation:
Lactase is an enzyme of mammals which is required to digest lactose. In humans (like in other mammals), lactase activity decreases during mid-childhood; although there are individuals which are still capable of producing this enzyme even during adult life, a trait known as 'lactase persistence'. Different mutations in the coding region of the lactase gene have been associated with lactase persistence in European, African and Asian populations. On the other hand, the niche construction theory states that the organisms, through their activities and choices, actively modify their own local environment by introducing novel selection pressures. Some examples of niche construction include, among others, alternation of nutrient cycling by plants or lactase persistence in humans. Lactase persistence can be defined as a case of niche construction because this trait was not only genetically inherited but also culturally transmitted through local environments shaped by ancestral populations, i.e., generated by niche construction or ecological inheritance.
Florida has many different land and water ecosystems.
TRUE
FALSE
Answer: That would be true.
HURRY I ONLY GOT 20 MINS!! 100 pints
Analyze the given diagram of carbon cycle below.
An image of carbon cycle is shown. The sun, a cloud, two trees, one on the left and the other on the right, an animal, lake, and a factory are shown in the image. An arrow is shown from the sun towards the left tree marked A. The sun is marked B. There is an arrow from the air above the clouds, marked C, towards the left tree. An arrow from a location close to the ground marked D points towards Dead Organisms, which is a label under the animal. An arrow marked E points from the right tree straight up to the clouds. An arrow marked F points from the animal straight up to the clouds. An arrow marked G points from the factory towards the air above the clouds, C. There is an arrow pointing from the air to the lake labeled Carbonates in Water, an arrow pointing down from dead organisms to Fossils and Fossil Fuels, and an arrow from Fossils to the factory.
Part 1: What is happening at location G?
Part 2: Which type of energy transformation is taking place at this location?
Part 3: Justify why this process is a recycling of carbon in the carbon cycle.
Use complete sentences to explain your answer.
Answer:
This is too difficult to read and understand... if you had a diagram I could be able to help more, but I can't figure out exactly what your asking... all I know is part A is CO2 being released into the atmosphere...
Hope you have a great day and if you have a diagram let me know.. I'd love to help :D
Answer:
Part I
At location G, the process of combustion is taking place where hydrocarbon or organic carbon from the fossil fuel is burnt in the presence of oxygen to produce carbon dioxide and water as the products.
CxHy = CO₂ + H₂O
Part II
At point G there is no transformation of energy since during the process of combustion energy will still be stored in form of chemical energy in the bonds of carbon Iv oxide and the water produced during the reaction.
Part III
The process shows recycling of carbon in the carbon cycle. This is because carbon from living organisms is cycled to non living organisms. When plants and animals die and are buried deep in the ground, they are then slowly converted to fossil fuels which contain organic hydrocarbon compounds including petrol, kerosene and other compounds. Then the fossils are used in the industries and undergoes combustion releasing carbon iv oxide which is then released to the atmosphere and used by the plants and animals. The process starts once again.
DISCLAIMER:
THIS WORK AIN'T MINE
I got it from the same question that was answered.
HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.
Answer:
No, because the scientist followed personalities which is pseudoscience.
Explanation:
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period
Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.
People born in October were more relaxed and could better handle stress
Is the scientist’s research considered science?
No, this are beliefs not necesarily true.
