A cylinder has a volume of 7,598.8 units^3 and a height of 5 units. How many units is the diameter of the cylinder? Use 3.14 for pi.

Answers

Answer 1

Answer:

219.99 or 219.98 or 220

Step-by-step explanation:


Related Questions

The Taft Public Library is a library built in the shape of a square. The checkout desk is located in the center of the building. You have been asked to help make a map of the library, using a coordinate plane. Since the library is 100 feet on each edge, you have decided to use a coordinate plane from -10 to 10 on each axis. Each unit represents 5 feet. The y-axis runs north-south, and the x-axis runs east-west.

The children's section is rectangular and has three of its corners at (-10,10), (-10,4), and (-3,10). What are the coordinates of the remaining corner?

Answers

The answer is (-3,4)

I'm definitely not understanding this question, please help! (try and explain if possible)

Answers

Answer:

96 inches squared or [tex]96in^{2}[/tex]

Step-by-step explanation:

So I'm assuming that the figure shown is the fragment that is left because it doesn't exactly say what it is.

The area of a rectangle is length times width, so to the area of the original manuscript is....

A=lw

A=20(12)

A=240

You get 20 from the question and 12 from the figure.

Next, you should find the area of the fragment that is left. I would split it up into two shapes, a triangle and recitable, since right now it's a weird looking shape. The area of a triangle is base time height divided by 2....

A=[tex]\frac{bh}{2}[/tex]

The base is 12 because 18-6=6 and the height is 12 because is the width of the original rectangle. (I suggest making a line in between fragment to spilt it into two shapes or even re-drawing it to see it more clearly.) Therefore plugging everything into the equation....

A=[tex]\frac{12(12)}{2}[/tex]

A=[tex]\frac{144}{2}[/tex]

A=72

Now to find the area of the rectangle of the fragment that is left over, use the the same equation from above that was used to find the area of a rectangle and just plug in the numbers 12 and 6 because you can use the number on the top and the number on the side of the figure

A=12(6)

A=72

The final step is to subtract the area of the smaller rectangle and triangle from the original manuscript

240-72-72=96

Therefore the answer is [tex]96in^{2}[/tex]. Hope this helps. : )

can you help me out

Answers

The correct answer is the letter B)

Answer:

B 1620 degrees! Good Luck Stay Brainly!

Step-by-step explanation:

Aaron uses 18% of the paper in a printer paper package when she print a report for social studies class about how many sheets of paper dose she use for her report

Answers

Answer:

0.18

Step-by-step explanation:

18% turned into a fraction is 18/100

and into a decimal form is going to be 0.18

so yeah I think I'm right

Answer:

You can't really answer (from what I think) if you don't know how much paper there is in a pack, but let's say there are 100 pieces of paper in a package and Aaron uses 18%, that would mean Aaron uses 18 pieces.

Step-by-step explanation:

divide 18 by 100= 0.18 which can be converted to 18% [tex]\frac{18}{100}[/tex] 0.18

Which ratios are equivalent to the given ratio?
15 to 30
Select each correct answer.
07:15
0 10:20
4 to 2
U
11 / 1
6
3

Answers

Answer:

10:20

Step-by-step explanation:

because 15 is half of 30

and then 10 is half if 20

The answer would be 10:20

Nico gave Charlie 56 marbles, 40% of Nico’s marble collection.
How many marbles does Nico have remaining?

Answers

Answer: 14 marbles

Step-by-step explanation: well nico had 54 marbles and 40% is with charlie so just subtract 54-40 and you'll get your answer

Nico had 140 marbles to begin with. After giving away 56, he would have 84 marbles left.

What is Proportional?

Any relationship that is always in the same ratio and quantity which vary directly with each other is called the proportional.

Now, we need to use some basic math.

Here, 56 marbles represent 40% of Nico's collection, then we can set up a proportion to find out how many marbles Nico had to begin with.

First, we'll set up the proportion:

56 / x = 40 / 100

Here, x represents the total number of marbles that Nico had before giving away 56.

Then, we get;

56 100 = 40 x

Multiplying both sides, we get:

5600 = 40x

x = 140

So, Nico had 140 marbles to begin with. After giving away 56, he would have 84 marbles left.

Learn more about the proportion visit:

https://brainly.com/question/1496357

#SPJ2

What are the measures of ∠ADC and ∠DCB in the figure?

Answers

Answer:

measure of angle ADC = 100°

measure of angle DCB = 39°

Step-by-step explanation:

We know that all the interior angles of a triangle add up to equal 180°, so we can set up an equation based on what we know from the figure (Angle C is the sum of [tex](4x-1)[/tex]° and [tex](2x+17)[/tex]°):

180° = 43° + 61° + [[tex](4x-1)[/tex]° + [tex](2x+17)[/tex]°]

180° = 43° + 61° + [tex]6x +16[/tex]°

180° = 104° + 16° + [tex]6x[/tex]

180° = 120° + [tex]6x[/tex]

60° = [tex]6x[/tex]

10° = [tex]x[/tex]

Now that we know the value of [tex]x[/tex], we can easily plug in 10° for [tex]x[/tex] in the angles we need to find.

The second angle we need to find uses [tex]x[/tex], so we can now find it. Angle DCB is, according to the figure, equal to [tex]4x-1[/tex].

[tex]4x-1[/tex]

[tex]4(10)-1\\40-1\\39[/tex]

Thus, the measure of angle DCB is equal to 39°.

However, angle ADC is defined in terms of [tex]y[/tex], so we'll have to find the value of [tex]y[/tex]. This is easy, however, because the two angles using [tex]y[/tex] meet together to form a straight line. Since we know that a straight line has an angle measure of 180°, we can once again set our equation equal to 180°.

180° = [tex](3y+7)+(3y-13)[/tex]

180° = [tex]6y[/tex] + 7° - 13°

180° = [tex]6y[/tex] - 6°

186° = [tex]6y[/tex]

31° = [tex]y[/tex]

Now, we'll simply substitute 31° for [tex]y[/tex] in the measure of angle ADC:

[tex]3y+7\\3(31)+7\\93+7\\100[/tex]

Therefore, the measure of angle ADC is equal to 100°.

The measure of <ADC is 100 Degree and measure of <DCB is 39 Degree.

What is Angle Sum Property?

The angle sum property of a triangle states that the sum of the angles of a triangle is equal to 180º.

Given:

First, (3y+ 7) + (3y - 13) = 180 (Linear Pair)

6y - 6 = 180

6y = 186

y = 31

So, measure of <ADC = 3y+ 7 = 3(31)+ 7 = 93 + 7 = 100 Degree

In Triangle ADC, using Angle Sum property

3y -13 + 61 + 4x - 1 = 180

93 - 13 + 61 - 1 + 4x = 180

4x = 40

x= 10

So, the measure of <DCB = 4x-1 = 4(10)-1 = 39 Degree.

Learn more about Angle sum Property here:

https://brainly.com/question/21364160

#SPJ2

It costs $5 per hour to rent a snowboard from a certain ski rental company, plus a $50 deposit. Another ski rental company charges $10 per hour to rent a snowboard, plus a $25 deposit. For what number of hours is the cost to rent a snowboard the same at each company? What is the cost of renting a snowboard for this number of hours

Answers

55, 35 I hope it’s right along with the deposit it should be right with the rental I hope it’s right!

The number of 5 hours is the cost to rent a snowboard the same for each company.

And the cost is $75.

What is an equation?

Two algebraic expressions having the same value and symbol '=' in between are called an equation.

Given:

It costs $5 per hour to rent a snowboard from a certain ski rental company, plus a $50 deposit.

Let n be the number of hours.

So, 5n + 50.

Another ski rental company charges $10 per hour to rent a snowboard, plus a $25 deposit.

10n + 25

When the cost is equal,

5n + 50 = 10n + 25

5n = 25

n = 5

And the cost is $75.

Therefore, all the required values are given above.

To learn more about the equation;

https://brainly.com/question/12788590

#SPJ2

What is the y-coordinate of the solution to the system of equations?

8x−9y=−61
x+9y=43
Enter your answer as the correct value, like this: 42

If your answer is a fraction, enter it in simplest form, formatted like this: 3/14

Answers

Answer:

The answer is 5.

Step-by-step explanation:

I got it right before.

Answer:

other user is right answer is five

Step-by-step explanation:

just did this on my test goodluck

A student attempted to generate an equivalent expression using the distributive property, as shown below: 5(x − 1) = 5x − 1 What was the mistake made? (1 point) 5 was not multiplied by x Incorrect sign was used for the first term 5 was not multiplied by −1 Incorrect sign was used for the second term

Answers

Answer:

the correct answer must be 5x - 5 not 5x - 1

Step-by-step explanation:

when we have a question such as 5(x - 1)

we must multiply both the numbers by 5

so we get 5 X x and 5 X -1

so it will be 5x - 5 which is the answer.

please mark brainliast

How is the area of each face of cube B related to the area of each face of cube A? B = 1 A = 256

Answers

Answer: 0

Step-by-step explanation: again just want the coins

Míchelle has 36 boxes of Girl Scout cookies for sale. She bought them for $4.00 per box.
On Monday, Míchelle sold 1/2​ of the boxes of cookies for $5.00 each.
On Tuesday, she sold 1/3 of the remaining boxes of cookies after Monday for $4.00 each.
On Wednesday, she sold the remaining boxes of cookies after Tuesday for $3.00 each.
How much money did Míchelle gain or lose selling cookies?

Answers

Answer: she earned like 7 dollars on Monday and on Wednesday she earned 10

Step-by-step explanation:

I times $4.00 by 1/2 and ad $5.00 for Monday and on Tuesday  i times 1/3  by $5.00 and for Wednesday i added $3.00 on to it so my answer is she earned like 10-20 dollars

I really hope this helps

Answer:

your so cute we should  go out

Step-by-step explanation:

ok baby

Use the model to add the fractions. (3 points)

A fraction strip partitioned into seven parts with one part shaded. Another fraction strip partitioned into seven parts with one part shaded. An addition sign separates the two fraction strips. After second fraction strip there is an equal symbol and another fraction strip with seven parts with no parts shaded. Under the first fraction strip is the fraction one seventh. Under the second fraction strip is the fraction one seventh.
a


two sevenths
b


four sevenths
c


five sevenths
d


six sevenths

no links pls..!

Answers

Answer:

Step-by-step explanation:

Thirty-five and six twenty-fourths m2Twenty-eight and ten twenty-fourths m2Twenty-eight and seven-tenths m2Twenty-two and ten-twelfths m2

WILL CHOOSE BRAINLIEST! DO 4 AND 5!

Answers

Answer:

To be honeest i dont know

Step-by-step explanation:

please answer this thx

Answers

height=two times the with because 18=2x9
H=2W
Height is 2 times the width! If you need explanation message me or comment.

HELP THIS IS DUE TODAY! Edit the graph and put answers if you do both I will give a brainlist answer.

Answers

Answer:

Object A is table ONE Object B is table TWO.

Object A is the Purple dots.

Object B is the Blue dots.

Where those dots are is how you will want to make your line.

Step-by-step explanation:

Hope this helped.

A brainliest is always appreciated.

Zachary buys a new car. The original price of the car is $29,100. The price of the car is then reduced by 15% because of a holiday sale. Sales tax on the car is 3%.

Answers

Answer:

25477.05

Step-by-step explanation:

Based on the given conditions, formulate: 29100 x (3% + 1) x (1 - 15%)

Calculate the sum or difference: 29100 x 1.03 x 0.85

Calculate the product or quotient: 25477.05

Will choose brainliest.

Answers

Answer:

Percentage of snails with narrow shells>>Start: 60%

Percentage of snails with narrow shells>> End: 167%

Percentage of snails with round shells>> Start: 239%

Percentage of snails with round shells>> End: 42%

Step-by-step explanation:

Mrs. Hanks bought 12-pound ham to serve for the holidays. She plans to serve each person 2/3 of a pound. The equation 2/3x = 12 can be used to determine x, the number of servings, What is the total number of serving she can make?

Answers

Answer:

18 Servings

Step-by-step explanation:

In this case all we need to do is reverse the functions of the equation in order to find the answer. When you take 12 and divide it by 2/3 you get the answer of 18.

Carlos is looking to buy a house where the floor plan shows the ratio of the area of the living room to the kitchen to the bedroom is 5 : 3 : 4. If the combined area of those three rooms is 360 square feet, how much larger, in square feet, is the living room than the bedroom?

Answers

It would be 240 degrees higher and 250 mm lower

Here is a diagram and its corresponding equation.
4x + 17 = 23
Find the solution to the equation.
x = ?
WILL GIVE BRAINLIEST PLEASE REAL ANSWER

Answers

x= 3/2 like the fraction 3 over 2

Answer: 3/2

Step-by-step explanation: 1

Subtract

from both sides of the equation

2

Simplify

Subtract the numbers

Subtract the numbers

3

Divide both sides of the equation by the same term

4

Simplify

Cancel terms that are in both the numerator and denominator

Divide the numbers

Solution

x=3/2

this is my final work piece please help me with it

Answers

Answer:

The perimeter is 36. (IM 99% SURE)

Step-by-step explanation:

I did this a week ago, trust me on this.

What is the volume of a cube with a length of 11 meters?


A. 33 m³
B. 121 m³
C. 1,221 m³
D. 1,331 m³


pls help me im a little brainless rat boi ;-;

Answers

Answer is D
V=S^3
So, 11^3= 1331

There ye go.

This should help.

PLEASE HELP QUICKLY!!!!!!! SCREENSHOT ATTACHED PLEASE DO ALL OF THEM

Answers

Answer:

A → (2, 3), B → (3 , 2)

Step-by-step explanation:

In point A,

Abscissa = 2

Ordinate = 3

Abscissa + ordinate

= 2 + 3

= 5

_________

In point B,

Abscissa = 3

Ordinate = 2

Abscissa + ordinate

= 3 + 2

= 5

=》It satisfies the condition.

Hope it helps ⚜

the answer is A->(2,3), B->(3,2)

This is a picture of a cube and the net for the cube.

What is the surface area of the cube?


in.2

Answers

9 I think because if you mutiny it I think that is the answer not sure tho sorry
36
SA=6S^2
SA=6x3^2
9x6=36

Order 74.585, 74.586, 74.486, and 74.587 in decreasing order.

Answers

Answer:

74.587, 74.586, 74.585, 75.486

Step-by-step explanation:

yes

74.587 , 74.586 , 74.585 74.486

hey can y’all help me

Answers

[tex] \huge{ \rm{Question:}}[/tex]

What is the internal angle sum of a polygon with 20 sides?

A) 3,240°

B) 3,420°

C) 3,600°

D) 3,780°

[tex] \huge{ \rm{Answer:}}[/tex]

A) 3,240°

HOPE THIS HELPS^^

First, 42 was divided by some number. the resulting quotient was then multiplied by 5. following this, 12 was subtracted from the product, giving 58. what was the initial divisor?
please show work and answer.

Answers

Answer:

42 ÷3 =14 × 5 = 70 -12 = 58

Step-by-step explanation:

the initial divisor was 3

Answer:

3

Step-by-step explanation:

42 divided by 3 = 14

14 x 5 = 70

70 - 12 = 58

WILL CHOOSE BRAINLIEST!!!

Answers

Answer:

2nd one i think

Step-by-step explanation:

hope it helps

2) If ΔABC and ΔXYZ are similar, which must be true? A) BC YZ = AC YX B) BC YZ = BA XZ C) AC XZ = BC YZ D) AC XZ = BA XZ

Answers

Answer:

(c)

Step-by-step explanation:

This is because,

Triangle ABC = Triangle XYZ

So,

AB = XY

BC = YZ

AC = XZ

The True statement is

AB / XY = BC / YZ = AC / XZ

What is Similarity?

Two triangles are said to be comparable if their two sides are in the same ratio as the two sides of another triangle and their two sides' angles inscribed in both triangles are equal.

We have,

ΔABC and ΔXYZ are similar.

Now, if ΔABC and ΔXYZ are similar then

The ratio of the corresponding side are equal

AB / XY = BC / YZ = AC / XZ

and, the corresponding angles are congruent

<A = <X, <B = <Y, <C = <Z

Learn more about Similarity here:

https://brainly.com/question/26451866

#SPJ5

Other Questions
7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA wouldyou see on the electrophoresis gel?BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 33TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5 GIVING BRAINALIST IF CORRECT + LIKESIs the tense correct in the example ?Were vegan our trip right now.A.)Yes B.)No HELP ME NOW!Which is a benefit of dynamic stretching? *increases heart rate increases oxygen and blood flow in the body improves range of motion all of the above Thabo rounded the number to the nearest 5. His answer was 340. Write down 2 possible number for the actual number of marbles In 1950 the ph of the pond water was 8. 2, but by 2000 the ph had decreased to 5. 2. An effective short-term remediation strategy for the pond would be to. The exterior of which American structure issimilar to that of the Pantheon in Rome,revealing the influence of ancient Greeceand Rome during the Neoclassical period inthe United States?O FallingwaterO Thomas Jefferson's MonticelloSolomon A. GuggenheimMuseumGreat Mosque of Cordoba Carter invested $3,900 in an account paying an interest rate of 3. 9% compounded daily. Assuming no deposits or withdrawals are made, how much money, to the nearest hundred dollars, would be in the account after 5 years? what is the capitol of finlad? Need to know If chicken costs 10 per ounce and grain costs 1 per ounce, how many ounces of each should Ruff use in each bag of dog food to minimize cost? Your friend annette complains of chronic heartburn. Which suggestion might be helpful to her?. 26m18m4m39mNeed to find the area of this shape anyone? What would be the effect of using a drug that stops further changes in the cell during G2 phase? What organelle converts food into a form of chemical energy the cells can use?MitochondriaNucleus Endoplasmic reticulumChlorophyll Malaya creates a password as follows: letter, number, letter, special character, number Assuming that there are 12 special characters, if you were trying to guess Malayas password, what is the most guesses that you would have to make? a. 702,000 b. 811,200 c. 205,476,480 d. 254,803,968. Solve the system of equations x - 4y = 7 2x + y = 5HTML EditorKeyboard Shortcuts A dilation with a scale factor of 3. 5 and centered at the origin is applied to PQ with endpoints P(2, 5) and Q(2, 1) Someone help me with this PLEASE HELP ILL GIVE BRAINLIEST Sara is making a cake in a trapezoidpan. The top base is 10 inches, thebottom base is 20 inches and theheight is 5 inches. She wants to coverthe top of the cake with pink frosting.Calculate how much frosting she willneed. Each frosting container covers acake with an area of 25 inches. Howmany containers will she need?A. 1 containerB. 3 ContainersO C. 2 containersOD. 4 containers Evaluate f(3) whenf(x)=(x^2+4x-7 Summarize how the Peer-to-peer payment process typically works?