Biology High School

Based on the diagram below, at which point is the most oxygen being
produced?
Oxygen in Plants and Time of Day
D
Dawn
Dusk
Dawn
OA. Point B
O B. Point C
OC. Point A
O D. Point D

Based On The Diagram Below, At Which Point Is The Most Oxygen Beingproduced?Oxygen In Plants And Time

Answers

Answer 1

Answer:

Point C dusk

Explanation:

if you follow the chart, the highest point is point C

Related Questions

2. Which of the following is a physical property of matter that is always the same regardless of size
or amount?

A. Mass
B. Volume
C. Density
D. Solubility

HELP

Answers

i think it’s D lol, it’s not mass because like duh and not volume and density like no?? so c because it’s always going to dissolve the same

Answer:

A

Explanation:

Since the law of conservation of mass is valid under all circumstances, hence, mass always remains the same, whether a substance undergoes physical change or chemical change

What is the probability for an average star to supernova?​

Answers

Answer:

Key concepts and summary. A supernova occurs on average once every 25 to 100 years in the Milky Way Galaxy.

Explanation:

please give me a heart

At which type of technonic plate boundary is a volcano least likely to occur​

Answers

Answer:  A

coz its just sliding one another

Hope it is correct

^_^

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water

Answers

50% water and 50% vinager

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Don’t comment unless you want a lot of notifications!!!


What are you if your Mexican black Asian white Hawaiian

Answers

Answer:

A human

Explanation:

HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ

Answers

Answer:

01). cells

02).seeing inside the cells

03).Robert hook

What causes weathering A. natural processes only B. chemical processes only
C. Weather related processes only D. physical and chemical processes

Answers

Answer:

I believe that the answer is A. Natural processes only, although I could be wrong.

Explanation:

There are two types of weather, mehanical and chemical, but I think the answer is A.

a cell with 12 chromosomes under goes mitosis, how many daughter cells are formed?
a. 2
b. 6
c.12
d 24

Answers

Answer:A

Explanation:

the answer would be A

Is energy used or not?

Answers

Answer:

Explanation:

energy is used, everything uses energy especially living organisms

Answer:

Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.

Explanation:

The annual cost of snow removal for streets and highways in the U.S.
is estimated to be about how much?
O $20 billion
$20 million
$2 billion
O $2 million

Answers

While many homeowners shovel snow themselves, some sign an annual snow removal contract. Highly rated snow removal contractors say customers who sign a contract. annual snow removal contracts in 2013 reported paying an average of $378, million 4 years ago.

State tax revenues in December and January fell far short. projected increases in outstanding debt and annual debt service. year and SFY 2019-20 by a total of nearly $2 billion. The initial Executive Budget proposed using $500 million of the U.S. economy, as of the end of 2018, was in.

For nearly 20 years, the American Society of Civil Engineers has been on average, there were 188 million trips across a structurally deficient. ASCE analysis of U.S. Department of Transportation, Federal Highway assistance and may finance over $2 billion in water infrastructure investment.

These are all from different things, hope one of them helped!! (but if they didnt, super sorry!)

The annual cost of snow removal for streets and highways is estimated to be $2 billion.

A report from the environmental department in one of the universities in the United States gave an estimation of 2.3 million dollars as what is spent yearly to get snow and ice off the streets and highway.

Snow removal is simply an action that is undertaken to get snow off the streets or road after it snowed for safe and easy movement of people.

In conclusion it is estimated to be about $2 billion dollars given 2.3 billion dollars is around this figure.

https://brainly.com/question/810446?referrer=searchResults

Whats number 9 and 10? It’s okay if you only do one..please help..

Equations for help:
K= C + 273
C= 5/9 (F - 32)
F= (C * 9/5) + 32

Answers

Answer:

9) 75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.

10)Since, 102.2°F is greater than 100°F, Stephen can't go to school today.

Explanation:

9) First, we want to find out 24°C converted to Fahrenheit

           What we want to find                   Equation

                   24°C = ?°F                         F= (C * 9/5) + 32

Second, we have to input our number into our equation

                                    F = (24 × 9/5) +32

Next, we have to use the PEMDAS strategy (ask in the comments if you don't understand!)

       24 × 9/5 =

      24 × 9 = 216                           216÷5 = 43.2

      1   ×   5 = 5

Now, we can't forget to add 32!

43.2 + 32 = 75.2°F

24°C = 75.2°F

75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.

10) For this problem, I'm going to just show the math, so if you have any questions feel free to ask in the comments!

Step 1) 312 = C + 273

           -273        -273

Step 2) 39 = C or C = 39

Step 3) F = (39 × 9/5) + 32

Step 4) F = (351/5) + 32

Step 5) F = 70.2 + 32

Step 6) F = 102.2

Since, 102.2°F is greater than 100°F, Stephen can't go to school today.(and should think about getting a regular thermometer ;)

Hope this Helps! :)

Have any questions? Ask below in the comments and I will try my best to answer.

-SGO

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.​

Answers

B) Evaporation , Unlike boiling, occurs at all temperatures

............................Please help ASAP ........................

Answers

Answer:

I think answer choice D

Explanation:

The passage summarized says that ostriches and rheas look exactly the same but are different sizes, therefore answer choice D is auto eliminated

9. Place the events in the correct order:
1. DNA polymerase adds nucleotides in the 5' to 3' direction
2.Replication fork is formed
3. DNA polymerase attaches to the primer
4. Okazaki fragments are bound together by ligase
5. DNA helicase unwinds DNA
ligaset

Answers

The correct order of events of DNA replication is as follows:

DNA helicase unwinds DNAReplication fork is formedDNA polymerase attaches to the primerDNA polymerase adds nucleotides in the 5' to 3' directionOkazaki fragments are bound together by ligase

DNA REPLICATION:

DNA replication is the process by which the DNA of a living organism is multiplied into two identical copies.

DNA is a double-stranded molecule, hence, it must first be separated into two single strands in order to be replicated.

The following are the orderly steps involved in DNA replication:An enzyme called DNA helicase unwinds DNA into single strands. A Y-shaped structure called replication fork is formed by the two single strands.DNA polymerase attaches to the primer, which is a short segment of RNA. DNA polymerase adds nucleotides to the leading strand of DNA in the 5' to 3' directionOkazaki fragments, which are small fragments of DNA are bound together by ligase enzyme and added to the lagging strand.

Learn more at: https://brainly.com/question/16464230?referrer=searchResults

PLZ ANSWER !!! DUE TODAY!!!!
what do molecules and ions move with in passive transport ?

Answers

Answer:

Also called facilitated transport or passive-mediated transport, facilitated diffusion occurs when molecules or ions are processed through spontaneous passive transport. The ions and molecules are moved across a biological membrane through certain transmembrane integral proteins.

Explanation:

There ya go!! Brainliest plss!! :))))

Practice 5: Match the statement ends to the beginnings
A Shell
D. Cell wall
B. Provides protection and support for the cell
E. Controls what goes into and out of the cell
C. Cell membrane
1. All cells have a
2. Plant cells have a
3. The cell membrane
4. The cell wall
5. The cell wall's function is similar to, or like a

Answers

Answer:

A-4. the cell wall

D-5. the cell walls function is similar to, or like a

B-2. plant cell have a

E-3. the cell membrane

C-1. all cell have a

what is a global fire

Answers

Answer:

a wild fire of a spreading fire that reaches a global span

Explanation:

Fireeeeeeeeeeeeeeeee

Identify the advantages and disadvantages of internal and external fertilization

Answers

When a sperm fertilizes an egg within the female, it is known as internal fertilization. The advantages of internal fertilization are that the fertilized egg is protected from predators and harsh environments, thus ending in higher chances of survival. Also, there is a lesser chance of desiccation of gametes. Disadvantages of internal fertilization are that there are lesser number of offspring produced at a given time because it is sometimes difficult for the male and female to come into intimate contact. Additionally, the risk of sexually transmitted diseases also increases.

1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.

Answers

Answer/Explanation:

During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.

But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.

Plz help me its only 1 question

Answers

Answer:

the first one

Explanation:

the car slowly started and accelerated

Its the second one. Since its continually accelerating.

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

if an object is 3 AU from the sun, it is

Answers

Answer:

That probably refers to asteroids.

Explanation:

There is a large belt of asteroids between the orbits of Mars and Jupiter.

what is a cell that is the source of other cells

Answers

Answer:

stem cells

Explanation:

Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?

Answers

Answer:

The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.

Explanation:

It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.

Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.

One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.

What is the cause of the toxic algae overgrowth in Prospect Park lake?

Phosphorus in the NYC tap water that feeds the lake. Phosphorus is put in the water to prevent lead from leaching into NYC's tap water.

Nitrogen from all of the dog poop surrounding the lake.

Combined sewage outfalls.

(This is 7th grade science).

Answers

Answer:

Harmful Algal Blooms (HABs) are produced by naturally occurring cyanobacteria in lakes and ponds, including the Prospect Park Lake and other bodies of water in the NYC area.

Explanation:

there is non

Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these​

Answers

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

What is carbon dioxide​

Answers

Answer:

Carbon dioxide is a colorless gas with a density about 53% higher than that of dry air. Carbon dioxide molecules consist of a carbon atom covalently double bonded to two oxygen atoms. It occurs naturally in Earth's atmosphere as a trace gas.

Answer:

The air that you breathe out. Also it is what plants breathe in.

Explanation:

Hope this helps!!

Other Questions
The first news paper in the world was started by? Name two sub-kingdoms of plant kingdoms identify like terms 2d 5f 2g 7 3g g plz i want the answer Suppose a stock had an initial price of $50 per share, paid a dividend of $.80 per share during the year, and had an ending share price of $38. Compute the percentage total return. (Negative amount should be indicated by a minus sign. Do not round intermediate calculations. Enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) What is the healthiest hydrator? ABCD is a parallelogram. AB = x + 16, AD = 4y 4, CD = 2x + 8. If the perimeter of ABCD is 80, find the value of y. Financial reports are created and used to evaluate the financial performance of the business. Which function is responsible for creating the reports sidh is making fruit salad. His recipe calls for pound of watermelon. He wantsto make of the amount of fruit salad in the recipe. How much watermelondoes Sidh need?more than poundless than 2 poundexactly 1 poundexactly poundMy Progress > which is a characteristics of all ions i want to make this into a wallpaper but it's too plain. what do you think i should do to it? HELP PLSSSWhat should the body of an essay contain in each paragraph?A. one topic sentence and three supporting detail sentences B. four supporting detail sentences about the topicOC. three topic sentences and one supporting sentenceD two topic sentences and two supporting sentences What Is The Prime Exponent Form Of 192 give answer fast...it's very important for me....then I give you 20 thanks...() 1. a rectangular room measures 10 feet by 12 feet. What is the area of the room? 2. What is the area of a rectangle with a base of 6 inches and height of 10 inches? 3. Travis is planting a rectangular garden that is 5 feet by 12 feet. One bag of soul covers 6 square feet. How many bags of soil does he need to cover the whole garden? please help with this. What are some of the things that Vincent had to do to enhance his genetic"imperfections?" so that he looked like the real Jerome? GATTACA 9,660 23 = equation Evaluate x + y , for x = 8 and y = -15A. 7B. 23 15 POINTS!C. -7D. -23 In a market economy resources tend to be allocated optimally. Discuss how the interaction of consumers and producers makes this happen.