Answer:
Look down!!! ;)
Explanation:
In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.
Hope this helps!! ;)
Is energy used or not?
Answer:
Explanation:
energy is used, everything uses energy especially living organisms
Answer:
Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.
Explanation:
What causes weathering A. natural processes only B. chemical processes only
C. Weather related processes only D. physical and chemical processes
Answer:
I believe that the answer is A. Natural processes only, although I could be wrong.
Explanation:
There are two types of weather, mehanical and chemical, but I think the answer is A.
if an object is 3 AU from the sun, it is
Answer:
That probably refers to asteroids.
Explanation:
There is a large belt of asteroids between the orbits of Mars and Jupiter.
What are the products of photosynthesis?
A. Water and oxygen
B. Glucose and oxygen
C. Carbon dioxide and water
D. Carbon dioxide and glucose
Answer:
B. Glucose and oxygen are the products of photosynthesisExplanation:
I hope it helps ❤️❤️HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ
Answer:
01). cells
02).seeing inside the cells
03).Robert hook
Whats number 9 and 10? It’s okay if you only do one..please help..
Equations for help:
K= C + 273
C= 5/9 (F - 32)
F= (C * 9/5) + 32
Answer:
9) 75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.
10)Since, 102.2°F is greater than 100°F, Stephen can't go to school today.
Explanation:
9) First, we want to find out 24°C converted to Fahrenheit
What we want to find Equation
24°C = ?°F F= (C * 9/5) + 32
Second, we have to input our number into our equation
F = (24 × 9/5) +32
Next, we have to use the PEMDAS strategy (ask in the comments if you don't understand!)
24 × 9/5 =
24 × 9 = 216 216÷5 = 43.2
1 × 5 = 5
Now, we can't forget to add 32!
43.2 + 32 = 75.2°F
24°C = 75.2°F
75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.
10) For this problem, I'm going to just show the math, so if you have any questions feel free to ask in the comments!
Step 1) 312 = C + 273
-273 -273
Step 2) 39 = C or C = 39
Step 3) F = (39 × 9/5) + 32
Step 4) F = (351/5) + 32
Step 5) F = 70.2 + 32
Step 6) F = 102.2
Since, 102.2°F is greater than 100°F, Stephen can't go to school today.(and should think about getting a regular thermometer ;)
Hope this Helps! :)
Have any questions? Ask below in the comments and I will try my best to answer.
-SGO
Plz help me its only 1 question
Answer:
the first one
Explanation:
the car slowly started and accelerated
Its the second one. Since its continually accelerating.
Don’t comment unless you want a lot of notifications!!!
What are you if your Mexican black Asian white Hawaiian
Answer:
A human
Explanation:
What is the cause of the toxic algae overgrowth in Prospect Park lake?
Phosphorus in the NYC tap water that feeds the lake. Phosphorus is put in the water to prevent lead from leaching into NYC's tap water.
Nitrogen from all of the dog poop surrounding the lake.
Combined sewage outfalls.
(This is 7th grade science).
Answer:
Harmful Algal Blooms (HABs) are produced by naturally occurring cyanobacteria in lakes and ponds, including the Prospect Park Lake and other bodies of water in the NYC area.
Explanation:
there is non
carlos made a diagram to compare two kinds of fish. which label belongs in the area marked Z?
a. scales
b. no jaw
c. swim bladder
d. skeleton made of bones
PLEASE HELP
Answer:
B
Explanation:
i also do edge
Which of the following characteristics of carbon is responsible for the variety of carbon-based molecules on Earth?
Answer:
It can form bonds.
Explanation:
(I'm in ap bio so I know a lot, lol, hope that helps)
n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water
50% water and 50% vinager
Blood vessels are connected to nerve fibers which are regulated by the
nervous system. When innervated they respond by doing what?
Answer:
When blood vessels are innervated they respond by contracting and relaxing their muscle wall, as a result of the activity of the autonomic nervous system.
Explanation:
The nerves that are responsible for the innervation of the blood vessels are called nervi vasorum, and are composed of nerve fibers of the sympathetic and parasympathetic nervous systems.
The innervation of the blood vessels specifically acts on the muscular wall of the vessel, so it contracts or relaxes depending on the activity of the nervous system:
Sympathetic nervous system stimulates vascular contraction.Parasympathetic nervous system makes the vascular smooth muscle relax.The action of the autonomic nervous system has an effect on blood pressure, being a determinant of normal or pathological behavior of the arteries.
a cell with 12 chromosomes under goes mitosis, how many daughter cells are formed?
a. 2
b. 6
c.12
d 24
Answer:A
Explanation:
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
which of the following correctly identifies the inheritance patterns arnoldo is observing?
the yellow allele is incompletely dominant...
Explanation:
The yellow allele is incompletely dominant.
What is Inheritance pattern?Genetic variation distribution in families is characterized by inheritance patterns. Predicting disease risk in a patient's family requires an understanding of these patterns.
Conditions brought on by pathogenic variations in a single gene are referred to as monogenic or Mendelian conditions.
Depending on the pattern of inheritance, a gene may be influenced by either one or both alleles.
Therefore, The yellow allele is incompletely dominant.
To learn more about Inheritance, refer to the link:
https://brainly.com/question/14930526
#SPJ6
I’m not sure if anyone knows this or not, can someone try and help me with this question!
Answer:
it gives them a mental picture of where they need to plant and pick the cotton
Explanation:
Hope this helps
PLZ ANSWER !!! DUE TODAY!!!!
what do molecules and ions move with in passive transport ?
Answer:
Also called facilitated transport or passive-mediated transport, facilitated diffusion occurs when molecules or ions are processed through spontaneous passive transport. The ions and molecules are moved across a biological membrane through certain transmembrane integral proteins.
Explanation:
There ya go!! Brainliest plss!! :))))
Please help worth 95 points. Project: Algae Cultures: Directions
In this report, you will be researching the different types of algae. Report on one algae from each of the three categories (blue-green, green, and green-brown). Include the following information: Name of the algae, Category if falls under, Where it is mostly found and what conditions it needs to survive, Whether it is unicellular or multicellular, Where in the food chain algae are, and what predators it may have, Research why some scientists think algae should be classified plants, and explain the debate.
1.Which organisms did you identify 2. How easy or difficult was it to find an example of each category? Which one was the hardest to find? Why? 3. Which environments were most common to find algae in? Why do you think so? 4. What part of the food chain is the alga? 5. Why is algae classified in the Protist Kingdom and not the Plant Kingdom even though they are photosynthetic? Research why scientists feel they should be classified as plants.
Answer:
1) I identified the Golden-Brown Algae.
2) It was very easy to find the category because of the solid color base and because it only had the daitoms. It did not have multiple like the Green Algae and the Blue-Green Algae.
3) In fresh, brackish or salt water. They are found both in tropical lakes and seas, and in the alpine and polar snows. They are unicellular or multicellular protist plant organisms, whose cells do not form tissues and lack flowers. They are considered the first link in the food chain in the aquatic environment. They are found in fresh, brackish or salt water. They are primary producers in the food chain, capable of producing organic substances through photosynthesis, so they use sunlight. They are found in tropical lakes and seas up to the alpine and polar snows.
4) Producer Alga is A plant and produces food for other organisms.
5) Algae (Euglena) do photosynthesis as plants do. They also move around and eat, as do animals. But they are unicellular. In order to be classified as a plant or animal, an organism has to be multicellular, made of more than one cell. Since it is a unicellular organism with some plant and animal characteristics, it is called a protist. Plant cells have walls while algae does't have one, so it is a protozoan. Algae resemble the protozoa, so they are put into the Protist Kingdom.
Explanation:
I had the project.
Algae recreate a major part of the marine ecosystem because they exist as the decomposers current in the marine ecosystem; any harm to them could cause an inequality in the whole marine ecosystem.
What are golden-brown algae?1)The Chrysophyceae, usually named chrysophytes, cryptomonads, golden-brown algae or golden algae exist as an extensive set of algae, seen mainly in freshwater.
2) It stood very easy to see the class because of the solid color base and because it only contained the diatoms. It did not contain multiple like the Green Algae and the Blue-Green Algae.
3) In fresh, saline, or salt water. They exist seen both in tropical lakes and seas and in the alpine and polar snows. They exist as unicellular or multicellular protist plant organisms, whose cells do not constitute tissues and absent flowers. They exist thought the first link in the food chain in the aquatic environment. They exist seen in fresh, brackish, or salt water. They exist as primary producers in the food chain, qualified of producing organic substances through photosynthesis, so they utilize sunlight.
4) Producer Alga exists in a plant and makes food for different organisms.
5) Algae (Euglena) accomplish photosynthesis as plants do. They even move about and eat, as do animals. But they exist unicellular. To be categorized as a plant or animal, an organism contains to be multicellular, made of better than one cell. Since it stands as a unicellular organism with some plant and animal elements, it exists named a protist. Plant cells contain walls while algae don't contain one, so it exists as a protozoan. Algae reach the protozoa, so they stand to put into the Protist Kingdom.
To learn more about algae refer to:
https://brainly.com/question/1747534
#SPJ2
what direction was the texas annexation in?
1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.
Answer/Explanation:
During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.
But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.
what is a global fire
Answer:
a wild fire of a spreading fire that reaches a global span
Explanation:
Practice 5: Match the statement ends to the beginnings
A Shell
D. Cell wall
B. Provides protection and support for the cell
E. Controls what goes into and out of the cell
C. Cell membrane
1. All cells have a
2. Plant cells have a
3. The cell membrane
4. The cell wall
5. The cell wall's function is similar to, or like a
Answer:
A-4. the cell wall
D-5. the cell walls function is similar to, or like a
B-2. plant cell have a
E-3. the cell membrane
C-1. all cell have a
The image below shows how wolves and dogs compare to some other animals in the levels of classification.
Based on this chart, which pair of organisms are most closely related?
Insect and rabbit
Cat and rabbit
Insect and fish
Cat and wolf
Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?
Answer:
The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.
Explanation:
It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.
Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.
One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.
Why might Ponyboy have idolized Pual Newman?
Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these
Answer:
all of these :)
Explanation:
i think
Answer:
Yes The Correct answer is ( All Of These)
explanation:
............................Please help ASAP ........................
Answer:
I think answer choice D
Explanation:
The passage summarized says that ostriches and rheas look exactly the same but are different sizes, therefore answer choice D is auto eliminated
