If a stream with a horizontal distance of 5 km begins at an elevation 200 m
higher than where it ends, what is its stream gradient?
Help me pls it’s due today
Answer: It's either B or C
Explanation:
how did advancements in technology help scientists better understand process of cell division?
Answer:
As is true for many fields of research, cell biology has always been ... Thanks to these advances we now have access to microscopes and ... You might then also realize that the new method, at least on paper, may have additional applications. ... which makes the technology attractive to yet more scientists.
Explanation:
Hoped I helped you out please mark me brainliest!!!
With the creation of the microscope, humans were able to observe plant and animal cells, and as technology advanced, scientists were able to learn more about these various types of cells.
What is a microscope?A microscope is a device that can be used to examine small objects, including cells. The image of an object is magnified in the microscope by at least one lens.
In most cases, the light is focused on the sample by passing it through a condenser.
After passing through the sample, the light passes through the objective lens, which magnifies the image of the sample, and then to the oculars, where the enlarged image is viewed.
The discovery of the green fluorescent protein (GFP), the development of increasingly sophisticated microscopes, and the development of in vitro assays that faithfully reproduce cellular functions are just a few examples of technological advances that have fueled many areas of cell biology.
Thus, it can be concluded that the advancements in technology help scientists better understand process of cell division.
For more details regarding microscope, visit:
https://brainly.com/question/18661784
#SPJ2
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
What is the main purpose of the light reactions?
Answer:
The overall purpose of the light-dependent reactions is to convert light energy into chemical energy. This chemical energy will be used by the Calvin cycle to fuel the assembly of sugar molecules.
To create ATP and NADPH to be used in the calvin cycle.
Explanation:
Hoped I helped please mark me brainliest!!
PLZ ASAP
A scientist is using a microscope to observe a type of
bacteria.
Which two structures would the scientist most likely see?PLEASE EXPLAIN WHY
A:nucleus and DNA
B:DNA and cell wall
C:cell wall and vacuole
D:vacuole and nucleus
Answer:
The two structures most likely to be observed by the scientist when looking at a type of bacteria under the microscope are cell wall and vacuole (option C).
Explanation:
Bacteria are prokaryotic organisms that lack a nucleus, most of the organelles, and whose DNA is dispersed in the cytoplasm. Some types of bacteria have a plasma membrane surrounded by a cell wall, and may be equipped with vacuoles to perform their functions.
It is very likely that two structures that are most likely to be differentiated when a type of bacteria is observed under the microscope are the cell wall and the vacuole, according with information above.
The other options are not correct because:
A and D. Bacteria lack a nucleus.
A and B. Bacterial DNA is dispersed in the cytoplasm and is very difficult to observe under the microscope.
Answer:
cell wall vacuole
Explanation:
blanced diet must contain enough energy to meet the body's needs what else must it contain
Answer:
Water
Explanation:
Answer:
A balanced diet should contain many good Factors and they are -It should be very healthy it should be lightit needs to be nutritional The diet should not make the person fatIt should provide better sleep It should keep away the diseases Hope u like my answerSkim the headings and bold words in this section. Write four steps scientists might take to solve a problem.
Answer:
1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion
The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.
What are hypothesis?A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.
Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.
Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.
The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.
A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.
Thus, by using these steps, scientist can come to an end for the problem.
For more details regarding hypothesis, visit:
https://brainly.com/question/17173491
#SPJ2
where do the microtubules of the spindle originate during mitosis in both plant and animal cells ??
What are the possible benefits of hybridization?
Answer:
Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.
True or false. The offspring that survived reproduces and pass on inherited characteristics DO NOT normally help them adapt to their environment.
Answer:
True
Explanation:
thx for the points
why does food get cold but drinks get hot
Answer:
it might be because of the room temperature.
Explanation:
since drinks are colder than the room temperature they will get warmer to be the same as the room temperature and because food is hotter than room temperature it gets colder to be the same as the room temperature. dont quote me on that just a guess
The rate at which a stars burns its fuel (gas) is based on the star's
Mass
Volume
Shape
Color
Answer:
based on the mass of the star
All energy comes from the sun. In 2-3 sentences, explain how it is transferred from one organism to another.
Answer:
When the sun rays come down into the atmosphere and the plants on the ground use photosynthesis to reproduce and eat. If an animal, for example, a bunny, eats grass the energy will be transferred to the bunny. If a fox eats the bunny, the energy transfers to the fox. the amount of energy will be reduced each time something is eaten because it keeps being consumed over and over.
Explanation:
i need some help here now ASAP
Answer:
None of those, its called Soul Horizons
Explanation:
Answer:
Soil Layers also know as Soil Horizons.
Explanation:
pleaseee help ASAPPP
3. How does changing the number of neutrons affect an atom?
Answer:
The change of number of neutrons does not affect the charge of the atom. All it will affect is your average atomic mass which is the sum of protons and neutrons.
Explanation: Hope this can help! ^^
Answer:
It will change the isotopes.
Which two structures are found at the outside of the cell?
Answer:
All cells share common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell.
How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years?
A.
The Grand Tetons will stay exactly the same as they are today.
B.
The Grand Tetons will become steeper and more rugged.
C.
The Grand Tetons will become less steep and more rounded.
D.
The Grand Tetons will become much taller than they are today.
Answer:
the correct answer to the question in c
Answer: C)The Grand Tetons will become less steep and more rounded.
Explanation:
How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years? C)The Grand Tetons will become less steep and more rounded.
4. Watson and Crick made a successful model of DNA based on
Rosalind Franklin's X-ray studies. This indicated that
DNA was
A. a triple helix with intertwined bases.
B. a double helix with bases outside the helix.
a. a double helix with bases inside the helix.
D. a single linear molecule of bases held together by
sugar-phosphate bonds.
Answer:
The right answer is the third statement.
--> A double helix with bases inside the helix.
This indicated that DNA was a double helix, with bases inside the helix. The correct option is c.
What is Watson and Crick's DNA model?Watson and Crick theorized that DNA is a double helix made up of two long helical strands twisted together.
In "Genetic Implications," Watson and Crick postulate that the replication of deoxyribonucleic acid, or DNA, may have a structural foundation. Scientists had just recently concluded that DNA contained genes, which were known to contain information that dictated an organism's identity when Watson and Crick proposed their theory of DNA replication.
In their model, each DNA strand was made up of discrete elements called bases, and the bases on one DNA strand matched the bases on the other.
Therefore, the correct option is c. a double helix with bases inside the helix.
To learn more about the DNA model, refer to the link:
https://brainly.com/question/5077600
#SPJ2
3. A house has several systems, such as the electrical system, plumbing system, and
heating and cooling system. In what ways are the systems of a house similar to
human body systems?
Question 9 of 10
Which process is a form of mechanical weathering?
Explanation:
abrasion, pressure release, thermal expansion and contraction and crystal growth.
How do genes control the production of proteins?
Describe the structure of the conjugated protein
haemoglobin, with reference to the levels of protein
structure.
Answer: Answer below, hope this helps! :D
Explanation:
A conjugated protein is a protein that functions in interaction with other (non-polypeptide) chemical groups attached by covalent bonding or weak interactions. ... The non-amino part of a conjugated protein is usually called its prosthetic group. Most prosthetic groups are formed from vitamins. Hemoglobin is a protein having a globular structure. Based on its structural properties, hemoglobin can be divided into two parts; a protein part and a heme group. The structure of the protein part can be studied at four levels; primary structure, secondary structure, tertiary structure, and quaternary structure.
What is the difference between a solar pillar and a sun dog?
Traits are controlled by
hybrids
alleles
purebreds
genetics
Answer:
Genetics
Explanation:
A trait is a specific characteristic of an organism. Traits can be determined by genes or the environment, or more commonly by interactions between them. The genetic contribution to a trait is called the genotype. The outward expression of the genotype is called the phenotype.
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
Which type of cell are found in the leaves of a tree?
O eukaryotic animal
O chloroplastic
O prokaryotic
O eukaryotic plant
Answer:
Palisade parenchyma cells
Explanation:
Palisade parenchyma cells are elogated cells located in many leaves just below the epidermal tissue. Spongy mesophyll cells occur below the one or two layers of palisade cells. Ray parenchyma cells occur in wood rays, the structures that transport materials laterally within a woody stem.
Answer:
eukaryotic plant
Explanation:Unit 2 Test: Cells
NEED HELPP ASAP
Which of these is the best explanation for why the rock on the ocean floor and the rock on the continent are
NOT the same age?
There has been a lot of erosion on the continent and the older rock has been washed away.
There has been a lot of erosion on the ocean floor and the older rock has washed away.
Due to the movement of the plates, the rocks that make up the ocean floor are pulled inside the earth
more often and are much younger.
Answer:The continental crust is less dense so the oceanic crust subducts back to the mantle. This process explains why the younger rocks are found on the ocean floor. 24.
Explanation:
O research existing data on accidents involving cars
communicate the results by telling everyone about the prototype
Question 3 (1 point)
There is a set number of times you should go through the engineering design process
- if your design isn't working by the 3rd time through, it's time to just quit and give
up.
True
False
To
Answer:
false
Explanation:
you fix your design to make it work that is what being is all about if it doesn't work you don't give up you figure out what is wrong and fix it.
