Answer:
Explanation:
The first big civilizations developed in river valleys, such as Mesopotamia, Harappa, and Ancient Egypt. Mesopotamia's culture thrived near the Tigris River, while Egypt's civilization thrived near the Nile.
7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?
BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'
5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5
Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.
What are restriction sites?Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.
Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.
Examples of restriction enzymes are Bam1 and EcoR1.
For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'
Two bands will be produced using Bam1 as shown below:
5'ACGAATTCAGTATTATCCTAGG 3'
3'TGCTTAAGTCATAATAGGATCC 5'
5'TATCCGCCGCCGAATTCTCATCA 3'
3'ATAGGCGGCGGCTTAAGAGTAGT 5'
For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'
Three bands will be produced using with EcoR1 as shown below:
5'ACGAATTC 3'
3'TGCTTAAG 5'
5'AGTATTATCCTAGGTATCCGCCGCC 3'
3'TCATAATAGGATCCATAGGCGGCGG 5'
5'TCATCA 3'
3'AGTAGT 5'
Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.
Learn more about restriction sites at: https://brainly.com/question/8886948
a strong acid would most likely have a pH of ?
a. 14
b. 1
c. 7
d. 10
Answer:
B. 1
Explanation:
Proteins are one of the three found in the diet and important structural molecules in living organisms.
a. True
b. False
During the cell cycle,chromatin will undergo changes in packing . State the two forms of chromatin and relate its structure to the process of DNA replication.
Chromatin exists in two forms. One form, called euchromatin, is less condensed and can be transcribed. The second form, called heterochromatin, is highly condensed and is typically not transcribed. Under the microscope in its extended form, chromatin looks like beads on a string.
Pa brainliest po
Fill in the blanks in Diagram 9. Complete the diagram by writing the names of the pathways in the
ovals and the names of the molecules in the boxes.
To fill the blanks you have to know that the IUPAC nomenclature or name,is a molecule's most expanded chain of carbons, connected by one bonds
IUPAC nomenclatureGenerally, as seen the question requires the IUPAC nomenclature of a certain compounds
Therefore,IUPAC nomenclature or name is a molecule's most expanded chain of carbons, connected by one bonds, also making reference to its form of bond chain or ring e.g 2,5,5-trimethyl-2-hexene
For more information on Molecules
https://brainly.com/question/19922822
I NEED HELP ASAP What is the best explanation for how the position of the ball changes after each second?
The force of gravity speeds up the ball.
The force of friction speeds up the ball.
The force from the girl's hand slows down the ball.
The force of gravity slows down the ball.
What three systems work together to make an animal move about?
a: nervous system, digestive system, muscular system
b: nervous system, skeletal system, muscular system
c: nervous system, circulatory system, muscular system
d: nervous system, digestive system, circulatory system
Answer:
B:nervous system,skeletal system,muscular system
Climate change is a cyclical event that has occurred throughout Earth's history. In recent years, the trend has been that
global temperatures are rising. If this continues throughout the 21st century, predict the effect it will have on Florida,
the flattest state in the United States.
Answer:
Click Tools, Internet options. ...The Internet Options window will open. ...Click Apply, OK to close the window.Click the wrench icon in the top-right corner of the browser.Select Options.In the 'On startup' section, select Open the home page.options window will open. Go to the Startup section and select When Firefox starts: Show my home page.. In the Home Page field, type in the website address you want to use as your home page.Click OK.
Explanation:
How would you take plant
lifespan type into account when
planning a garden?
Answer:
Explanation:
Annuals-replant every year
Biennale-Won’t flower the first year planted and need to be replanted after their second year of growing
Perennials- will grow back each spring
Annuals-replant every year as the Biennale won’t flower the first year planted and need to be replanted after their second year of growing and Perennials- will grow back each spring.
What is five kingdom classification?The main purpose of the classification of the Five kingdom has been known R.H. Whittaker. The five kindoms that has were included in this proposal were the Fungi, Protista, Monera.
Animalia as well as the kingdom Plantae. There are mainly five criteria or the conditions based on which the classification has been madeup of. These criteria has been includes the structure of the cell, as well as the nutrition mode, organisation of the thallus, or the relations of reproduction and phylogenetic.
Based on shoe characteristics they were to develop a classification hierarchy of shoes, beginning with the shoe "kingdom" and becoming more and more specific, just like scientists did for the classification of living things.
Therefore, Annuals-replant every year as the Biennale won’t flower the first year planted and need to be replanted after their second year of growing and Perennials- will grow back each spring.
Learn more about kingdom on :
https://brainly.com/question/14688752
#SPJ2
The 16s rRNA gene encodes an RNA that would be used as a component of the _________ during ____________.
a. RNA polymerase, transription
b. a protein, DNA replication
c. the ribosome, translation
d. tRNA, DNA replication
The 16s rRNA gene encodes an RNA that would be used as a component of the ribosome during translation (Option c). It is a ribosomal RNA.
What are ribosomal RNAs?Ribosomal RNAs (rRNAs) represent fundamental components of the ribosomes, the protein factories of the cell.
Ribosomes play central roles during the process of translation by which an mRNA is used as a template to produce a polypeptide.
The 16S rRNA is a constituent of the bacterial small ribosomal subunit, which is used during translation.
Learn more about ribosomal RNAs here:
https://brainly.com/question/930760
is fission radioactive ?
I NEED HELPPP
Answer:
yes
Explanation:
i took the test
Answer:
Yes it is 'The fission products themselves are usually unstable and therefore radioactive'
Explanation:
Source: wikipedia
identify the main function of a stereo dissection microscope
Answer: Allows a magnified 3-Dimensional perspective when dissecting. This enables more accuracy in movements.
Explanation:
The _____ of the brain is more active during visual imagery encoding. inner left temporal lobe lower left frontal lobe upper left frontal lobe occipital lobe
Answer:
parietal and occipital cortices
Explanation:
• Seasonal movement to a different geographical region where
conditions are more favorable
Answer:
Maybe a more warm location???
Explanation:
Which of the following can be the product of an expressed gene?
• DNA
• Protein
• Chromosome
• Part of a Protein
• a switch telling other genes when to expresses or not
TEXT REFERENCE HERE ➪
Answer:
part of a protein
Explanation:
part of a protein
if an electric motor uses 50 kj of energy to do 46 kj of work, how efficient is it
Answer:
8%
Explanation:
Efficiency = 1 - Q1/Q2
= 1 - 46/50
= 1 - 0.92
= 0.08
= 8%
A soccer player has been sprinting up and down the field. She is breathing
very hard and has a burning sensation in her muscles. Which of these is the
most likely cause of the burning in her muscles?
A. Fermentation produced too much lactate due to anaerobic
conditions.
B. Glycolysis produced too much pyruvate due to aerobic conditions.
C. The Krebs cycle used up too much carbon dioxide.
D. Electron transport chains produced too much ATP.
The ileum has an acidic environment due to the presence of hydrochloric acid.
true or false
Answer:
true
Explanation:
Explain how the model of inheritance for the orange fur trait causes
this distribution of orange fur within
the cat population.
Explanation:
fair standards ensure fairer term of trade between farmers and buyers protect workers right ,provide the framework to producers to build thriving farms organization
Can someone please help me with this I’ll give u brain list just please !
What is a role of a scientist?
A to report accurate results
B to keep scientific secrets
C to tell people how the must
live
D to dictate government policy
Asap
2. In the lesson you learned that relative time is when the passage of time is judged according to
some other "marker" of time, such as how worn a cow's teeth are. List two examples of
measurements of time that are relative.
From what we know, we can confirm that any measurement of time is relative when being compared to another passage of time.
What are some examples of relative time?As stated, time, as with any measurement, becomes relative when compared to something else. For example:
A six-hour class can be considered extremely long, however, it is minuscule when compared to the hours present in a full calendar year.Another possible example is how the life of a human is relatively short when compared to the time of existence of the human race.Therefore, we can confirm that any measurement of time is relative when being compared to another passage of time, as shown with the above examples.
To learn more about relativity visit:
https://brainly.com/question/164109?referrer=searchResults
which statement BEST describes the reason for the change in the cell membrane model?
The new model was the result of a vote by scientists.
The new model help scientist avoid more research.
The new model came from more experiments and evidence.
The new model is based on the researchers best guess.
Answer:
The new model came from more experiments and evidence.
Explanation:
As more research and better technology came out scientists were able to update to a more accurate model.
4. What is the carrying capacity of Wildebeest in the Serengeti?
Answer:
1,300,000
Explanation:
Explain that this limit is called the carrying capacity, and that it is the largest population size that the environment can support in the long run.
What is the best description of a biome? a An interdependent system of plants, animals, and land. b A system of trees, forests, and rivers. c A habitat where large numbers of animals live. d An area with significant amounts of rainfall.
Answer:
A
Explanation:
i need an explanation for this myth i have made for my science assignment "why are fish and plants not in the same phylum"
Answer:
They can't be in the same phylum because they are in two different categories on the basis of Mode of nutrition. Plants are autotrophs, while animals are heterotrophs. Cell wall is present in plant cells, while it is absent in animal cells.
Explanation:
A phylum is a major group of animals or in some classifications plants sharing one or more fundamental characteristics that set them apart from all other animals and plants/
What is a cell with no nucleus?
Answer:
Prokaryotes are cells with no nucleus
HELP PLEASE I NEEED THIS RIGHT NOW
Can someone please tell me if this is the right order
Input of energy in most communities comes from the
sun
A. phytoplankton of the oceans
B.
C. tropical rainforest
D. agricultural productivity
Answer:
A: phytoplankton of the ocean
