Describe and explain how a single plant cell can grow into a new multicellular
plant.

Answers

Answer 1

Answer: Every cell in a plant contains all the genetic information to create specialized and unspecialized tissues. It uses gene expression and regulation to control what those cells become after mitosis making it easy to create different types of cells from one cell.

Explanation:


Related Questions

i need an explanation for this myth i have made for my science assignment "why are fish and plants not in the same phylum"​

Answers

Answer:

They can't be in the same phylum because they are in two different categories on the basis of Mode of nutrition. Plants are autotrophs, while animals are heterotrophs. Cell wall is present in plant cells, while it is absent in animal cells.

Explanation:

A phylum is a major group of animals or in some classifications plants sharing one or more fundamental characteristics that set them apart from all other animals and plants/

The ileum has an acidic environment due to the presence of hydrochloric acid.
true or false​

Answers

Answer:

true

Explanation:



HELP PLEASE I NEEED THIS RIGHT NOW

Answers

Why do butterflies like flying to different places after the atmosphere changes it’s weather and why do butterflies likes certain weather in the atmosphere


Not sure if it’s asking questions but correct me if I’m wrong

A soccer player has been sprinting up and down the field. She is breathing
very hard and has a burning sensation in her muscles. Which of these is the
most likely cause of the burning in her muscles?
A. Fermentation produced too much lactate due to anaerobic
conditions.
B. Glycolysis produced too much pyruvate due to aerobic conditions.
C. The Krebs cycle used up too much carbon dioxide.
D. Electron transport chains produced too much ATP.

Answers

A is closest.

Lactic acid build up that’s a byproduct of because of anaerobic respiration (occurs when there’s not sufficient oxygen to oxidise the glucose).
The correct answer is A) “Fermentation produced too much lactate due to anaerobic conditions.”

Can someone please tell me if this is the right order

Answers

Yes I guess this is the right order

I NEED HELP ASAP What is the best explanation for how the position of the ball changes after each second?


The force of gravity speeds up the ball.


The force of friction speeds up the ball.


The force from the girl's hand slows down the ball.


The force of gravity slows down the ball.

Answers

Initially the force from the girls hand speeds up the ball. And when it’s at its zenith (highest point) the force of gravity pulls it towards the earth and speeds the ball up.

Of those four the first explains it best
Probably the force of gravity speeds up the ball

What is the best description of a biome? a An interdependent system of plants, animals, and land. b A system of trees, forests, and rivers. c A habitat where large numbers of animals live. d An area with significant amounts of rainfall.

Answers

A biome can be best described as an interdependent system of plants, animals, and land.
Option A is the correct answer

However, it is a habitat or large area which is characterised by its vegetation, soil, climate, and animals.

Answer:

A

Explanation:

Even though individuals only have two alleles for any given gene, there may be many different alleles for that gene within the human population. What is the term for this phenomenon?
Group of answer choices

Multiple alleles

Genetic diversity

De novo mutation

Allelic variety

Answers

Answer:

Genetic diversity

Explanation:

Genetic diversity is when a population of a species, humans, in this case, have different genes between different individuals. One person may have blue eyes while the others have brown. This shows diversity within the gene pool.

Genetic diversity is also important to the survival of a species. Two-parent reproduction leads to genetic diversity. Having different alleles within a population allows for adaptation. On the other hand, one-parent reproduction does not allow for genetic diversity. This hinders the species because it does not let species to slowly improve the gene pool through natural selection and adaptation.

The 16s rRNA gene encodes an RNA that would be used as a component of the _________ during ____________.

a. RNA polymerase, transription

b. a protein, DNA replication

c. the ribosome, translation

d. tRNA, DNA replication

Answers

The 16s rRNA gene encodes an RNA that would be used as a component of the ribosome during translation (Option c). It is a ribosomal RNA.

What are ribosomal RNAs?

Ribosomal RNAs (rRNAs) represent fundamental components of the ribosomes, the protein factories of the cell.

Ribosomes play central roles during the process of translation by which an mRNA is used as a template to produce a polypeptide.

The 16S rRNA is a constituent of the bacterial small ribosomal subunit, which is used during translation.

Learn more about ribosomal RNAs here:

https://brainly.com/question/930760

is fission radioactive ?
I NEED HELPPP

Answers

Answer:

yes

Explanation:

i took the test

Answer:

Yes it is 'The fission products themselves are usually unstable and therefore radioactive'

Explanation:

Source: wikipedia

if an electric motor uses 50 kj of energy to do 46 kj of work, how efficient is it

Answers

Answer:

8%

Explanation:

Efficiency = 1 - Q1/Q2

= 1 - 46/50

= 1 - 0.92

= 0.08

= 8%

What is a role of a scientist?

A to report accurate results

B to keep scientific secrets

C to tell people how the must
live

D to dictate government policy

Answers

The answer is (A)
Hope this helps

how was earth created ?

Answers

Answer:

Formation.

Explanation:

Earth formed when gravity pulled swirling gas and dust in to become the third planet from the Sun.

a strong acid would most likely have a pH of ?

a. 14
b. 1
c. 7
d. 10

Answers

Answer:

B. 1

Explanation:

What are the 4 components of natural selection?

Answers

variation, overpopulation, reproduction, competition

Can someone please help me with this I’ll give u brain list !!

Answers

Answer:

Here u go ;)

Explanation:

Livestock :- animals that are kept for the goods they offer and that can be sold for profit

Overharvesting :- catching or removing from a population more organisms than the population can replace

Aquaculture :- involves raising aquatic organisms for human use

Drought :- lack of water in an area causing crops to die

Famine :- the social and economic crisis in a given area that is commonly characterized by widespread malnutrition, starvation, etc.

Malnutrition :- when an organism does not consume enough nutrients needed to fulfill the body's needs

Diet :- The type and amount of food a person eats

Pesticides :- Chemicals that protect crops from harmful plants and insects

Carbohydrates :- Primary source of energy for the body

Erosion :- the wearing away of soil by wind and water

Compare and contrast each of the following pairs of terms: (a) circulatory system and cardiovascular system, (b) complete blood count and complete blood count with differential.

Answers

The circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.

What is circulatory system and cardiovascular system?

The cardiovascular system covers those structures (heart and blood vessels) that allow blood and lymphatic circulation (circulatory system).

What is a complete blood count?

It is a scheme that allows to represent the composition of the blood.

What is a complete blood count with differential?

It is one of the tests that allows counting each of the leukocyte types.

Differences between circulatory system and cardiovascular system, complete blood count and complete blood count with differential

Circulatory system and cardiovascular system are linked to the set of organs and structures that allow blood and lymph to travel through the body.

A complete blood count examines the types and numbers of cells in the blood: white blood cells, red blood cells and platelets by performing a blood count of these main cells.

A complete blood count with differential is used to diagnose and monitor many different conditions, including anemia measuring the percentages of each type of white blood cell.

Therefore, we can conclude that the circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.

Learn more about circulatory and cardiovascular system here: https://brainly.com/question/1023001

What does the term “evolution” mean to you

Answers

Answer:

In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.

Explanation:

Answer:

evolution means the making of judgement about the amount number or value of something

How might evidence obtained from genetic counselors change the lives of families?

Answers

Answer:

Genetic counseling can help you proactively identify genetic risk factors, based on an expert review of your personal and family health histories.

Explanation:

A genetic counselor can help you get appropriate genetic testing and address risks through personalized medical recommendations for you and your doctor to put into action.

Which of the following can be the product of an expressed gene?

• DNA
• Protein
• Chromosome
• Part of a Protein
• a switch telling other genes when to expresses or not


TEXT REFERENCE HERE ➪

Answers

Answer:

part of a protein

Explanation:

part of a protein

Input of energy in most communities comes from the
sun
A. phytoplankton of the oceans
B.
C. tropical rainforest
D. agricultural productivity

Answers

Answer:

A: phytoplankton of the ocean

which statement BEST describes the reason for the change in the cell membrane model?

The new model was the result of a vote by scientists.

The new model help scientist avoid more research.

The new model came from more experiments and evidence.

The new model is based on the researchers best guess.

Answers

Answer:

The new model came from more experiments and evidence.

Explanation:

As more research and better technology came out scientists were able to update to a more accurate model.

• Seasonal movement to a different geographical region where
conditions are more favorable

Answers

Answer:

Maybe a more warm location???

Explanation:


4. What is the carrying capacity of Wildebeest in the Serengeti?

Answers

Answer:

1,300,000

Explanation:

Explain that this limit is called the carrying capacity, and that it is the largest population size that the environment can support in the long run.

6. In the food chain shown, which animals are prey? (Select all that apply.)
grass
grasshopper
frog
snake
eagle

Answers

Answer:

Grasshopper and frog.

Explanation:

Hope this helps.

Answer:frog, snake, eagle

Explanation:

identify the main function of a stereo dissection microscope

Answers

Answer: Allows a magnified 3-Dimensional perspective when dissecting. This enables more accuracy in movements.

Explanation:

Can someone please help me with this I’ll give u brain list just please !

Answers

Natural Selection show that the animals will survive based on there genetics

7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?

BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'

5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5

Answers

Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.

What are restriction sites?

Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.

Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.

Examples of restriction enzymes are Bam1 and EcoR1.

For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'

Two bands will be produced using Bam1 as shown below:

5'ACGAATTCAGTATTATCCTAGG 3'

3'TGCTTAAGTCATAATAGGATCC 5'

5'TATCCGCCGCCGAATTCTCATCA 3'

3'ATAGGCGGCGGCTTAAGAGTAGT 5'

For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'

Three bands will be produced using with EcoR1 as shown below:

5'ACGAATTC 3'

3'TGCTTAAG 5'

5'AGTATTATCCTAGGTATCCGCCGCC 3'

3'TCATAATAGGATCCATAGGCGGCGG 5'

5'TCATCA 3'

3'AGTAGT 5'

Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.

Learn more about restriction sites at: https://brainly.com/question/8886948

During the cell cycle,chromatin will undergo changes in packing . State the two forms of chromatin and relate its structure to the process of DNA replication.​

Answers

Chromatin exists in two forms. One form, called euchromatin, is less condensed and can be transcribed. The second form, called heterochromatin, is highly condensed and is typically not transcribed. Under the microscope in its extended form, chromatin looks like beads on a string.

Pa brainliest po

can you make an example sentence of a physical change?​

Answers

Answer:

when water turns into ice.

Explanation:

it changes the physical phases of matter.  

Answer:

Lila put some ice cubes in a tray and left them out on the kitchen counter for thirty minutes. When she came back the ice was melted, so she had to put them back in the freezer to refreeze.

Explanation:

A physical change is a generally reversible change. Eg. Ice melting, dissolving sugar and water, and boiling water are all examples of physical change!

Hope this helps :)

Other Questions
The average breaking strength of a certain brand of steel cable is 2000 pounds, with a standard deviation of 100 pounds. A sample of 20 cables is selected and tested. Find the sample mean that will cut off the upper 95% of all samples of size 20 taken from the population. Assume the variable is normally distributed. What is the probability In a standard 52-card deck, Jacks (J), Queens (Q), and Kings (K) are considered face cards. If a card is selected from a well-shuffled deck, find the probability that the card is a face card. simplify the following ratio R5,75:25cents The sum of X and Y is 90. Which statement is TRUE?X is acute and Y is obtuse.Both X and Y are right angles.X is obtuse and Y is acute.Both X and Y are acute angle Which is the best example of author Carolyn Cinami DeCristofanos use of humor in A Black Hole is NOT a Hole?If the Sun suddenly turned purple, you wouldnt see it happen.Events beyond the black holes horizon are invisible to us.Even though you know its still out there in space, you cant see it.After it sinks below the horizon, Earth blocks your view of it. What is 9 x 10-2as an ordinary number? Give your answer as a decimal. Please help me I really need help how do u solve 20 = x 4.6 How can family life educational help to control human trafficking? Choose the preposition a cause de or the conjunction parce que to complete this sentence.Je suis en retar pour l'ecole ____ ma voiture ne marche pas.Je vais organiser une fete ____ mon anniversaireMes amis vont a une soiree ____ la fete de la Saint-Valentin PLS HELP IM BEING TIMED 2 FOR BRAINLIESTPhyllis is going ice skating. the cost to rent figure skates for x hours is given by the functionf(x) = 1.50x + 2.00. the cost to rent hockey skates for x hours is given by the functionh(x) = 2.00x +1.50.If phyllis rents skates for 3 hours, how much cheaper would figure skates be thanhockey skates?(Note: Express the answer as dollars.cents. Solve the following absolute value inequality can someone tell me how to write English file class 10 term 2 please on Amanda and bholi topic Answer question in the picture below Jerry bought 4 dvds for 25. What was the unit rate ? (Civil case) How does a person wind up in court non-criminally? Fill in the blanks in Spanish Please please help What type of text structure is MOSTLY used in this text? 4. Three Bean Salad Puzzle #1A bean salad has 20 beans in all. It is made up of:1/2 lima beans 2/5 red beans 1/10 black-eyed peas How many of each type of bean are in the salad? if a=5+2i, b=-3+i and c=4i(2+3I), determine ab+c in simplest a+bi form In which stage of the group development process are group members asking, "how can i best perform my role?".