Does side lengths 2, 5 and 7 form a right triangle

Answers

Answer 1

Answer:

No, it doesn't

Step-by-step explanation:

2+5=7

The two smaller lengths of a triangle cannot be equal to or less than the third side.


Related Questions

please help me


i'll mark u as brainly if u give me the correct answers

Answers

Answer:

49π cm²

Step-by-step explanation:

Diameter (d) = 14 cm

Radius (r) = d/2 = 14/2 = 7 cm

Area of a circle

= πr²

= π × (7)²

= 49π cm²

Hope it helps ⚜

Information provided with us :

Diameter of the given circle is 14 cm.

What we have to calculate :

Area of that circle?

Performing Calculations :

Here we would be first calculating the radius of the given circle. As we know that radius of the circle is calculated by the formula,

r = d / 2

Putting the values,

=> r = 14 / 2

=> r = 7

Therefore, radius is of 7 cm.

Now, heading up to calculate the area of circle.

Formula,

A = πr²

Putting the values in the formula,

=> A = 22/7 (7)²

=> A = (22/7) × 7 × 7

=> A = 22 × 7 × 7 / 7

=> A = 22 × 49 / 7

=> A = 22 × 7

=> A = 154 cm²

A number (a) rounded to the nearest 10 is 240. Another number (b) rounded to the nearest 100 is 300. a and b are whole numbers. What is the greatest difference between a and b?

Answers

Answer:

64

Step-by-step explanation:

a = 235

b = 299

d (difference) = b - a

d = 299 - 235

d = 64

Difference between 3/5of Raman's present age and his age before 4years is zero. What will be his age after 5 years ?​

Answers

Answer:

[tex]11 \frac{2}{3} [/tex]

Years

Step-by-step explanation:

Let x be his current age

[tex] \frac{3}{5} x - 4 = 0 \\ x + 5 = [/tex]

Solve the expression:

[tex] \frac{3}{5} x - 4 = 0 \\ + 4 \\ \frac{3}{5} x = 4 \\ \times \frac{5}{3} \\ x = 4( \frac{5}{3}) \\x = \frac{20}{3} \\ x = 6 \frac{2}{3} [/tex]

[tex]x + 5 \\ 6 \frac{2}{3} + 5 \\ 11 \frac{2}{3} [/tex]

There are 20 socks in a drawer, all the same size, that are blue, green and red. The probability of picking a blue sock is 20%. The probability of picking a green sock is 50%. What is the probability of picking a red sock from the drawer?

Answers

Answer:

30%

Step-by-step explanation:

Probabilities are always out of 100%

50+20=70

100-70=30

send me a photo of 360 angle ruler​

Answers

Answer:

The image below shows an image of a 360 degree ruler.

Step-by-step explanation:

Once a week Mrs. Baker makes sugar cookies.
The first week she makes the recipe, she uses
the 2 full cups of sugar called for. Each week
after that, she reduces the amount of sugar
by one third. How much sugar does she use
for cookies over 8 weeks? (Hint: The common
ratio is not 1/3.)

Answers

By getting the exponential decay that models the situation, we will see that after 8 weeks she uses 0.12 cups.

How much sugar does she use each week?

We know that the first week, she uses 2 cups of sugar, and each week she uses removes one-third of what she used the previous week.

Then the second week she uses:

S₂ = 2 cups - (1/3)*(2 cups) = 2 cups*(1 - 1/3) = 2 cups*(2/3)

The third week she uses:

S₃ = 2 cups*(2/3) - (1/3)*2 cups*(2/3) = 2 cups*(2/3)^2

You already can see the pattern, at week x, she will use:

Sₓ = (2 cups)*(2/3)^(x - 1)

This is an exponential decay.

To get how much sugar does she uses after 8 weeks, we just replace x by 8 in the above equation:

S₈ = (2 units)*(2/3)^(8 - 1) = 0.12 cups of sugar.

If you want to learn more about exponentials, you can read:

https://brainly.com/question/11464095

Consider the equation and the graph

Answers

Answer:

-33/16

I'm pretty sure it is c sorry if not may be -39/16

hellllllllppppppppppppppppppppp plllllsssssssssssssssssssssss

Answers

Answer:

$12.50

Step-by-step explanation:

The shop offers a discount, buy 8 pounds for the price of 5.

Answer:

20

Step-by-step explanation:

10 plus 10 is 20 and 4 pounds is 10 therefor its 20

Over time, the number of organisms in a population increases exponentially. The table below shows the approximate
number of organisms after y years.
y years
1
2
3
4
number of organisms, n
55
60
67
75
The environment in which the organism lives can support at most 600 organisms. Assuming the trend continues, after
how many years will the environment no longer be able to support the population?

Answers

Answer:

B

Step-by-step explanation:

I got it right in ed2022

Answer:

Correct, answer is indeed 24.

Step-by-step explanation:

took the quiz

Two circles centered at the origin are graphed on the coordinate plane. The smaller circle has a radius of 2 units and the larger circle has a radius of 8 units.

Answers

The equations that describe the given circles are:

x^2 + y^2 = 4

x^2 + y^2 = 64

How to get the equations for the circles?

For a circle of radius R, centered at the point (a, b), the equation is:

(x - a)^2 + (y - b)^2 = R^2

In this case, we have two circles, both centered on (0, 0), but one has a radius of 2 units and the other a radius of 8 units, then we have two equations:

x^2 + y^2 = 2^2 = 4

x^2 + y^2 = 8^2 = 64

These are the two equations that describe the given circles.

If you want to learn more about circles, you can read:

https://brainly.com/question/25306774

Why can you not do negative numbers to the power of 1. 5?.

Answers

Answer:

Lets say we have (-1)^(1.5)

Step-by-step explanation:

(-1)^(1.5) = (-1)^(3/2)

= (√(-1))^3 which has no solution in the real number field, as √(-1) does not exist.

In the complex number field √(-1) = i, and (-1)^(1.5) = i^3 = -i.

Please help this is so confusing

Answers

Step-by-step explanation:

The ones that apply are:

1) 10t + 5s = 190

2) t + s = 30

No. 1 is because each tumbler is $10 making 10t and each hat is $5 making 5s and the total sales is $190

No. 2 is because the total tumblers and hats sold add up to 30

Sometimes all you need is a different perspective :)

Hope this helps!

Please mark as brainliest :)

Sal’s pizza shop can make 7 pizzas in 15 minutes. At this rate, how many pizzas can they make in 4 hours?

Answers

Answer:

112 pizzas

Step-by-step explanation:

There are 60 minutes in an hour, means that Sal's pizza shop can make 28 pizzas an hour. Multiply this by 4 to get 112

Answer:112

Step-by-step explanation: I got you Breh

You see first you divide 4 hours by 15 minutes and you get 16 minutes.

To confirm that you can do 16 x 15 and it would be 240, and 4 hours is 240 miniutes.

Now you multiply 16 by 7 and you get 112


Hope this helps

550 m:1.1 km simplify the ratio​

Answers

Step-by-step explanation:

Ratios can be fully simplified just like fractions. To simplify a ratio, divide all of the numbers in the ratio by the same number until they cannot be divided any more.

Need help please answer

Answers

I’m pretty positive x is 74 and I hope this helps you

what is 7x1+1x1+1X1+1-0X + 0x2 + 2x simplified

Answers

Answer:

Simplify the expression.

X+10x+1

Answer:

X+10x+1

Step-by-step explanation:

this would be your answer

Explain how to find 2 1/4 divided by 1 1/2!!

Answers

Answer:

1 1/2

Step-by-step explanation:

ILL GIVE BRAINLIEST

Assume:

+There are 365 days a year

+No spoilage issues

+Pi= 3.14

Answers

Answer: Assume π = 3.14(rounded upto two decimal point)

Case I. 1 year = 365 days

2 years = 730 days

3 years = 1095 days

And .14 years = 51 days 2 hours 24 minutes

So, 3.14 years = 1146 days 2 hours 24 minuts.

Now, suppose you born in a leap-year.

Case II. 1 year = 366 days

2 years = 732 days

3 years = 1098 days

and .14 years = 51 days 5 hours 45 minutes 36 seconds

Then, 3.14 years = 1149 days 5 hours 45 minuts 36 seconds

So, yes, it is possible to be exactly π years old. At exactly 1146 days 2 hours 24 minutes or 1149 days 5 hours 45 minutes 36 seconds (in case of a leap-year born), we could have celebrate at our π years birthday.

Step-by-step explanation:

Solve the system of equations

a+s=560

8a+3s=2905

Answers

Answer:

a=245 s=315

Step: Solve a+s=560 for a:

a+s=560

a+s=560(Add -s to both sides)

a=−s+560

Step: Substitute −s+560 for a in 8a+3s=2905:

8a+3s=2905

8(−s+560)+3s=2905

−5s+4480=2905(Simplify both sides of the equation)

−5s+4480=2905(Add -4480 to both sides)

−5s=−1575

−5s=−1575(Divide both sides by -5)

s=315

Step: Substitute 315 for s in a=−s+560:

a=−s+560

a=−315+560

a=245

The term solution is related to the word solve what do you think a solution might be

Answers

Answer:

something attained by mental effort and especially by computation

is called a solution, When you solve you get the solution meaning you have to tryed and never given up , to gain the solution.

Identify the angles of rotational symmetry for the figure.​

Answers

Answer:

60°

Step-by-step explanation:

The internal angLe is 60°

Which of the following sets of numbers could represent the three sides of a triangle?

Answers

Answer:

( 8 , 15 , 24 )

option d is the correct answer

Why did the Texans fought in the civil war

Answers

Answer:

Texans fought in the Civil War for states' rights, sectionalism, and to keep their slaves.

Texans fought in the Civil War to protect State Rights.

Texans fought in the Civil War for states rights, sectionalism, and to keep their slaves. Texans fought in the Civil War to protect State Rights.

need help please. math question.

Answers

Answer:

I think it's C

Step-by-step explanation:

360°-232° = 128°

How many 1/4 cup servings of milk are in a 4-cup container? show your math

Answers

Answer:

You need 16 1/4 cups to fill up a 4-cup container.

Step-by-step explanation:

essay about why people should not join a gang ​

Answers

Answer: Joining a gang will not give you more protection; it could enhance your chance of being targeted as a victim. Gang members make far less money than those who do not join gangs. Gang members usually don't get a good education, making it hard to find a good job. Gang involvement increases your risk of being arrested, having to go to court, being put on probation or parole, being jailed, injured, or even killed. Being a gang member is a dangerous thing. Often, members realize this once they have joined the gang and want to leave. It is never easy to leave a gang because as a member you have information that could be shared with authorities like the police – and as a result, get the gang members in trouble. You would always be getting in trouble with the law because you would apart of a gang group. Gangs often steal, break in peoples houses, break in to their cars and etc. Gang members leave you to take the blame so the other ones would not get caught and go to jail. Being in a gang is really bad for you because if you did didce to leave the gang then they might come and kill you and your family because they have no respect for other people.

Hope it helps

Pablo is mailing packages. Each small package costs him $2.20 to send. Each large package costs him $3.70. How much will it cost him to send 1small package and 5 large packages?

Answers

Answer:

$20.70

Step-by-step explanation:

5 × $3.70 = $18.50 + $2.20 =

$20.70

Tell me an rounded to the nearest 10th of needed of the following data set is 30,29,40,51,39,24,60,40,35,58

Answers

30, 30, 40, 50, 40, 20, 60, 40, 40, 60

i need help with this math i am not very good at it

Answers

Answer:

44 sq. in.

Step-by-step explanation:

Area (total) = (1/2)(3)(4) + 10(3) + (1/2)(8)(2)

= 6 + 30 + 8

= 44 sq. in.

help asap this question is from timeforlearing i will give 100 points and brainly

Answers

Answer:

[tex]\sf 4[/tex]

Explanation:

[tex]\sf \frac{1}{4} (15+h)-g[/tex]

[tex]\sf given: h = 5 , \ g = 1[/tex]

solve:

[tex]\sf \frac{1}{4} (15+5)-1[/tex]

[tex]\sf \frac{1}{4} (20)-1[/tex]

[tex]\sf 5-1[/tex]

[tex]\sf 4[/tex]

Other Questions
P1-1A On April 1, Julie Spengel established Spengel's Travel Agency. The following trans-actions were completed during the month.1. Invested $15,000 cash to start the agency.2. Paid $600 cash for April office rent.3. Purchased equipment for $3,000 cash.4. Incurred $700 of advertising costs in the Chicago Tribune, on account.5. Paid $900 cash for office supplies.6. Performed services worth $10,000: $3,000 cash is received from customers, and thebalance of $7,000 is billed to customers on account.7. Withdrew $600 cash for personal use.8. Paid Chicago Tribune $500 of the amount due in transaction (4).9. Paid employees' salaries $2,500.10. Received $4,000 in cash from customers who have previously been billed in transac-tion (6).Instructions(a) Prepare a tabular analysis of the transactions using the following column headings:Cash, Accounts Receivable, Supplies, Equipment, Accounts Payable, Owner's Capital,Owner's Drawings, Revenues, and Expenses.(b) From an analysis of the owner's equity columns, compute the net income or net lossfor April. Find the value of x. Leave your answer in simplest radical form. Select the correct answer.Simplify the following expression.x^-2/3 x x^6/7A. B. C. D. How do I work this out? Someone explain fully please 16.) The population of Wolf County was 12,390 in 2000 and 13,090 in 2010. Assuming that population growth in this county is linear, find the following: b.) When will the population reach 21,000 people? c.) When did the first settlers arrive in Wolf County? In the measurement 0.342, which number is the estimated digit? The (_______________________________) Clause means that states must recognize the judgments, legislation, and public records of other states. 1.Interstate Commerce2.Privileges and Immunities3.Due Process4.Equal Protection5.Full Faith and Credit Which subatomic particle is correctly paired with its properties?A) Proton: positively charged, mass about equal to that of an electronB) Neutron: no electric charge, mass about equal to that of a protonC) Electron: negatively charged, mass about equal to a neutronD) Positron: negatively charged, mass about equal to that of a proton. What event determines when a chromatid becomes a chromosome. Questions1. An object travels 3 meters in 1.5 seconds. What is its velocity? 7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA wouldyou see on the electrophoresis gel?BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 33TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5 GIVING BRAINALIST IF CORRECT + LIKESIs the tense correct in the example ?Were vegan our trip right now.A.)Yes B.)No HELP ME NOW!Which is a benefit of dynamic stretching? *increases heart rate increases oxygen and blood flow in the body improves range of motion all of the above Thabo rounded the number to the nearest 5. His answer was 340. Write down 2 possible number for the actual number of marbles In 1950 the ph of the pond water was 8. 2, but by 2000 the ph had decreased to 5. 2. An effective short-term remediation strategy for the pond would be to. The exterior of which American structure issimilar to that of the Pantheon in Rome,revealing the influence of ancient Greeceand Rome during the Neoclassical period inthe United States?O FallingwaterO Thomas Jefferson's MonticelloSolomon A. GuggenheimMuseumGreat Mosque of Cordoba Carter invested $3,900 in an account paying an interest rate of 3. 9% compounded daily. Assuming no deposits or withdrawals are made, how much money, to the nearest hundred dollars, would be in the account after 5 years? what is the capitol of finlad? Need to know If chicken costs 10 per ounce and grain costs 1 per ounce, how many ounces of each should Ruff use in each bag of dog food to minimize cost? Your friend annette complains of chronic heartburn. Which suggestion might be helpful to her?.