The nerves in the body send signals along their pathway to the spinal cord, then to the brain. Once the signals reach your brain, your body registers the sensation, and you are able to feel it. Sensory signals travel so fast that it seems like you get the message instantaneously.
I need help with this practice problem solving In your own words answer my pic below all
Answer:
Kudzu was intentionally introduced to North America by the Soil Erosion Service and Civilian Conservation Corps in the 1930s for the purpose of controlling soil erosion in the American Southeast.
Without albumin in plasma, what will happen? (Multiple answers)
A. Water will leave the blood vessels.
B. Water will be urinated out of the body at a greater rate.
C. Tissues will swell with water.
D. Blood volume and pressure will be reduced.
E. Blood volume and pressure will be elevated.
Answer:
water will leave the blood vesseld
1. Which process happens when a
small root and stem begin to grow
out of a seed?
Answer:
Germination
Explanation:
The beggining growth of the plant
Answer:
Germination
Explanation:
It's when the seed takes water from the soil. This trigger root growth to allow the seed get more water. It then develops and grows towards the sun above ground
A hockey puck with a mass of 0.12 kg is traveling across the ice at a velocity of 150 m/s downfield. What is the momentum of the
hockey puck? (1 point)
OM 18 kg* m/s
OP 8*10-4 kg * m/s
OP 18 N
O P = 18 kg* m/s
Hey there! Lets begin!
1. Which of the following best describes the sum of all forces acting on an object?
Net force, which is a vector sum.______________________________________________________
2. Suppose a man is sitting on a chair and exerting 100 N of force downward, while a spring beneath the chair exerts 150 N of force upward. If you assign a negative value to the downward force, what is the net force of this system?
50 N_______________________________________________________
3. During a game of pool, a cue ball travels to the left with 70 N of force and collides with the four ball moving with a force of 50 N to the right. If you assign a negative value to the force moving to the right, what is the net force of this system?
20 N_______________________________________________________
4. Recall that the formula for momentum is:
P=mv
Which of the following correctly shows momentum being calculated?
45 kg * m/s = (9 kg)(5 m/s)_______________________________________________________
5. A hockey puck with a mass of 0.12 kg is traveling across the ice at a velocity of 150 m/s downfield. What is the momentum of the hockey puck?
P = 18 kg * m/s_______________________________________________________
Hope this helps! Good luck!
Answer:
(Question) Which of the following best describes the sum of all forces acting on an object?
(Answer) net force, which is a vector sum
(Question) Suppose a man is sitting on a chair and exerting 100 N of force downward, while a spring beneath the chair exerts 150 N of force upward. If you assign a negative value to the downward force, what is the net force of this system?
(Answer) 50 N
(Question) During a game of pool, a cue ball travels to the left with 70 N of force and collides with the four ball moving with a force of 50 N to the right. If you assign a negative value to the force moving to the right, what is the net force of this system?
(Answer) 20 N
(Question) Recall that the formula for momentum is: P=mv Which of the following correctly shows momentum being calculated?
(Answer) 45 kg*m/s=(9 kg) (5 m/s)
(Question) A hockey puck with a mass of 0.12 kg is traveling across the ice at a velocity of 150 m/s downfield. What is the momentum of the hockey puck?
(Answer) P=18 kg*m/s
Explanation:
I just finished the quick check UwU
Explain the structure and function of venous valves in the large veins of the extremities?
The structure of venous valves in the large veins of the extremities is that the the valves in the veins are hemispherical in shape and are made up of Elastic tissue. These valves are lined by the endothelium like the rest of the veins. Beneath this endothelium, elastic tissue is present in the form layers or lamellae.
The functions of the of venous valves in the large veins of the extremities is is to keep the blood moving in one direction which is back up towards the heart.
What are veins?Veins are regarded as blood vessels located throughout your body that collect oxygen-poor blood and return it to your heart.
Veins are generally part of your circulatory system which work together with other blood vessels and the heart to keep blood moving in the body.
Learn more about veins at: https://brainly.com/question/393019
#SPJ1
Which one of the following statements about intracellular transport is TRUE?
a. kinesin and myosin move substances along microtubules
b. kinesin moves substances along microfilaments
c. kinesin and dynein move substances along microtubules
d. kinesin and dynein move substances along microfilaments
The true statement about the intracellular transport is option C. kinesin and dynein move substances along microtubules.
Intracellular transport is the movement of vesicles and materials within a cell. Intracellular shipping is needed for preserving homeostasis in the cellular by responding to physiological alerts.
The primary difference between intercellular and extracellular fluid is that intracellular fluid is the liquid found in the cell whereas extracellular fluid refers to all the frame fluids outdoor the cell. Intracellular transport is important for maintaining the right mobile function in maximum eukaryotic cells, with perturbations in lively shipping ensuing in several kinds of sickness.
Cytoskeleton Determines the location of Organelles inside the mobile. Intracellular shipping of molecules and organelles is liable for their delivery to vacation spot websites.
Learn more about intracellular transport here:-https://brainly.com/question/25802833
#SPJ4
The anatomy of spiders and insects is structurally identical.
Please select the best answer from the choices provided:
True
False
please look at the picture
Answer:
The B is the correct ANSWER.
Explanation:
Did the WES2 station move at a constant speed since 1995?
Answer:
probably not
Explanation:
When a velocity's magnitude and direction do not alter over time, it is said to be constant.
What is meant by Constant speed?Constant speed refers to a speed that remains constant throughout the duration of the motion. Constant speed is demonstrated in our example of using cruise control while driving a car.
When a velocity's magnitude and direction do not alter over time, it is said to be constant. In other words, this occurs when an object's rate of change in location remains constant throughout time.
An object is considered to be moving at a constant speed when it covers the same distance in the same amount of time. When moving at a constant place, an object covers a certain distance in a fixed amount of time. S = dt is a formula that can be used to express the speed.
To learn more about Constant speed refer to:
https://brainly.com/question/13672913
#SPJ13
4. A(n) ______________ is an organism that contains a gene from anotherorganism.A. cloned organismB. inbred organismC. transgenic organism
An organism that contains genetic material that has been isolated from another organism and inserted into it by biotechnological tools is known as a transgenic organism, and this is usually done to produce organisms that have a desired genome to, for example, have a resistance to some pathogens that could harm it otherwise, such as plagues, and this is because the inserted DNA produce a genetic output in terms that the organisms can now produce proteins that before it couldn't.
We can see this process currently used in the agricultural industry, where some plants have external genetic material in them, such as tomatoes or apples.
Answer:
Explanation:
C. transgenic organism
Transgenic refers to an organism or cell whose genome has been altered by the introduction of one or more foreign DNA sequences from another species by artificial means. Transgenic organisms are generated in the laboratory for research purposes.
A gecko, which has a spinal column and climb walls, can be classified as what type of animal? An ArachnidAn AmphibianAn invertebrateA vertebrate
Given the characteristics provided: a spinal column and climbing walls; we can classify the gecko as a vertebrate because it has a spinal column (option D).
To make a more specific classification, we would need to know more characteristics of the gecko.
Given the structure of protein, why is the energy that is released as heat during chemical reactions not useable for work in biological systems?
Energy exists in different forms, some of which are electrical, heating, chemical, luminous, among others.
Chemical energy in biological systems is based on the formation-breaking of bonds: to form a bond, energy must be expended, while when a bond is broken, energy is released.
Often, these processes require the participation of enzymes within the organisms; enzymes are proteins that decrease the activation energy of a reaction. For example, if a lot of energy is needed to break a bond, the enzyme will help to lower the energy required.
In biological systems such as humans, the energy molecule is ATP, which releases energy when a bond is broken and a phosphate group is released, leaving ADP as a product. And although it is an efficient process, the laws of thermodynamics explain that no process is 100% efficient, and therefore, some amount of energy is always released in the form of heat. Unlike chemical energy, heat energy is not stored in bonds and cannot be catalyzed by enzymes or utilized by biological systems.
What is the number of different genetic combinations available in a given gene pool?A) Genetic combinationsB) Genetic diversityC) Genetic variationD) Genetic assortment
The correct answer is B) Genetic diversity.
Genetic diversity i
The process that allows molecules to move through a protein channel from an area of high concentration to low concentration.
A. Active Transport
B. Simple Diffusion
C. Osmosis
D. Facilitated Diffusion
Answer: D. Facilitated Diffusion
Explanation: Two classes of proteins that mediate facilitated diffusion are generally distinguished: carrier proteins and channel proteins.
List similarities of digestive system of human and of a frog digestive system
Frogs and humans have the same organs in its digestive system, and their functions are the same. That means that, except a few differencies, frogs and humans digestive systems are mainly the same. Both of them consists of esophagus, stomach, small intestine and large intestine, as well as the mouth. The organs work together in a similar way, digesting food since the mouth until the intestine.
What molecule fits easily through the cell membrane's phospholipid bilayer?
A Protein
B Oxygen
C Glucose (Sugar)
D Salt
Answer:
B
Explanation:
since gases can pass through the phopholipids bilayer :)
HELP ME PLEASE
In what types of food is the protein content the highest?
Answer:
According to the WebMD, seafood, lean beef (including tenderloin, sirloin, and eye of round) and lean pork, eggs, beans, and low-fat dairy products have the highest protein content.
Which of the following statements concerning cell membranes is/are correct?
Cells membranes are a phospholipid bilayer, with the hydrophobic "tails" of the phospholipids oriented to the interior of the bilayer, and the hydrophilic "heads" to the exterior of the bilayer.
They are fluid, which means that other molecules in them, such as proteins, are not fixed in position. One of the components of the membrane in animal cells is cholesterol, which helps to give rigidity and strength to the membrane
The cell membrane is impermeable to ions and polar molecules, while hydrophobic molecules can pass by passive diffusion.
This means that only statement 2 is true (option b).
I’m am unsure of the steps to solve this and what to get for the answer
Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.
Mutation 1
5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'
Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.
3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'
Same sequence but from 5' - 3':
5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'
Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:
Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys
It should be noted that each chain will give rise to different amino acid sequences.
Cells need energy in order to perform most cellular processes. This energy is produced throughthe process of cellular respiration. Which of the following describes this process.A. water is transported into the cell to create ATP.B. sugar molecules are broken down to produce ATP.C. light is captured and used to build sugar molecules.D. carbon dioxide molecules are combined to create protein molecules.
The correct answer is B. sugar molecules are broken down to produce ATP. In cellular respiration sugars are broken down. During the process, they release energy that allows the cell to produce ATP.
Hello I need help with this practice problem solving In your own words, shortly answer my pic above
The harmfully invasive Kudzu was introduced in the U.S. during the Philadelphia Centennial Exposition in 1876 where it was presented for sale as a green ornamental plant.
Kudzu is a green sturdy vine that is a climber. It is known for its sweet-smelling blooms. It is harmfully invasive because it poses great competition for the native plant, from grasses to large trees, and outcompetes them all by shading them and depleting them with their share of sunlight.
Ornamental plants are those that are grown for the purpose of decoration. These can be grown in gardens, fields or even indoors. Some examples of ornamental plants are: Snake Plant, String Of Pearls, Peace Lily, Chinese Money Plant, Air Plant and Water Bamboo.
To know more about Kudzu, here
brainly.com/question/11776380
#SPJ1
which statement best describes an example of how climate change leads to decreased biodiversity?
A. Increased rains in dry regions cause more plants to grow,
increasing the ecosystem's resiliency.
B. High temperatures become more common farther from the
equator, leading to increased stability of the ecosystem.
C. Warmer arctic regions allow for increased animal populations,
changing the ecosystem's resiliency.
0
D. Sea levels rise due to increased temperatures, flooding coastal
areas and leading to an unstable ecosystem.
The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.
What is Ecosystem?This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.
An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.
Read more about Ecosystem here https://brainly.com/question/842527
#SPJ1
Does diffusion take place in the nervous system? if it does, how so?
Answer:
In living things, diffusion allows substances to move in and out of cells. It's how red blood cells distribute oxygen through the body. When empty blood cells enter the lungs, which have an extremely high concentration of oxygen, the molecules pass into the blood cells, filling them up.
Explanation:
Which response represents the largest to the smallest, in terms of size?Select one:a.eukaryotic cell, prokaryotic cell, virusb.prokaryotic cell, virus, eukaryotic cellc.virus, eukaryotic cell, prokaryotic celld.eukaryotic cell, virus, prokaryotic cell
The correct option that represents the largest to the smallest, in terms of size is a.
Which of the following is true of jet streams?
A It is found close to the ground
B It occurs only in the stratosphere
C It's a current of fast moving air
D It's a current of stationary air
what element is this
Help assp…..
What are the divisions of the PNS? (Choose all that apply)
A.autonomic nervous system
B.reflex arc
C.parasympathetic nervous system
D.somatic nervous system
it is B C and D
Hope this helps
Reflex arc, parasympathetic nervous system and somatic nervous system are the divisions of peripheral nervous system.
What are the functions of peripheral nervous system?The peripheral nervous system is one of two components that make up the nervous system of bilateral animals, with the other part being the central nervous system. The PNS consists of nerves and ganglia, which lie outside the brain and the spinal cord.
The peripheral nervous system refers to parts of the nervous system outside the brain and spinal cord. It includes the cranial nerves, spinal nerves and their roots and branches, peripheral nerves, and neuromuscular junctions.
The peripheral nervous system is divided into two main parts: Autonomic nervous system (ANS): Controls involuntary bodily functions and regulates glands.
Learn more about peripheral nervous system:
https://brainly.com/question/23605940
#SPJ2
Question #1
Long Text (essay)
Pretend you are a financial counselor and the Johnsons have come to you for help with constructing an estate plan. You will make
recommendations to them for an estate plan to protect and prepare themselves and their family in the event of their passing. Your
recommendations will take the form of a two-page report, listing areas of concern and action items.
Answer: An estate plan is a collection of documents and includes a will, guardianship designations, healthcare power of attorney, beneficiary designations, durable power of attorney, and a personal letter of intent, outlining your wishes, should you die or become incapacitated.
Explanation: i tryed my best
These are low organs that carry out cell function number 2
Eukaryotes have a nucleous.
One of the main differences between eukaryote and prokaryote cels is that the first ones have nucleous and se second ones don`t.
Which gas is transported by the circulatory system in humans and is USED BY cells during respiration to release energy stored in food? *A Carbon DioxideB NitrogenC HydrogenD Oxygen
In order to answer this question, we must remember a bit of cellular metabolism, when mitochondria carry out the process of cellular respiration we can see that in the electron transport chain the final acceptor of electrons is oxygen. Therefore the correct answer for the question is option D oxygen.
