explain how global warming can lead to the flooding of low lying areas?

short answer or easy words answer.​

Answers

Answer 1

Answer:

When water warms up it expands. At the same time global warming causes polar ice sheets and glaciers to melt. The combination of these changes is causing sea levels to rise, resulting in flooding and erosion of coastal and low lying areas.

Explanation:

hope this helps

Answer 2

Explanation:

Global warming leads to melting of icecaps in polar regions this increase in mean sea level which further leads to flooding in low lying areas we can solve this problem by checking production of greenhouse gases like carbon dioxide methane etc


Related Questions

what is the nucleus of a cell

Answers

A membrane bound organelle where chromosomes/ genetic information is stored.

Which of the following can be performed to determine spread of infection to the bloodstream?
a. Blood culture
b. Biopsy
c. MRI
d. CT

Answers

Answer:

Biopsy

Explanation:

Another way can be used sepsy .

Biopsy:-

It is a process in which thorough surgery a piece of tissue is removed from your body .

(NEED HELP ASAP) 5. Would pedigrees be useful for studying traits with multiple alleles, such as blood type? What about traits that are coded by multiple genes? Justify your answer.​

Answers

Answer:

Yes, a common example of this is hemophilia. Pedigrees can determine patterns in generations and can represent a trait with a half-shaded circle, fully shaded circle, or a blank circle.

What is a carbon sink or carbon reservoir?
O A place where carbon is stored
O A place where carbon is changed

Answers

A carbon sink is a place where carbon is stored

its style was said to be a modifiaton of the marching mode

Answers

Answer:

yes

Explanation:

yes yes yes yes yes yes yes yes

Answer all questions please!

Answers

Answer:

The presence of misfolded proteins elicits cellular responses that include an endoplasmic reticulum (ER) stress response that may protect cells against the toxic buildup of misfolded proteins [3–7].

A human cheek cell's cycle is 24 hours. The stages within the cell cycle vary in length. G1 phase - 11 hours, G2 phase - 4 hours, S phase - 8 hours, M phase - 1 hour. Why does the cell spend 23 hours in interphase (G1-S-G2), while it spends only one hour in the M phase?

a.Interphase consists of the Gap 1 and Gap 2 phases, in which the cell is dormant while the chromosomes align.
b.Interphase is when cells are dormant while they decide whether they want to replicate their chromosomes.
c.Interphase follows mitosis, when daughter cells double their chromosomes, which takes 23 hours.
d.Interphase takes a long time because it is a preparatory stage where the cell makes proteins and organelles and doubles its chromosomes.

Answers

Answer:

answer is c

Explanation:

The cell needs a lot of preparation and checks in G1, S and G2 to do mitosis. especially in the G1 phase which is the longest phase. It is explained by the fact that the cell should "rest and recover" after the last mitosis before getting into the second one

Answer: C

Explanation: I took the quiz

Review Map D. Predict future weather for New Orleans, LA. What weather might occur there? What is the cause of this weather? Predict the future weather for Washington, DC. What is the cause of this weather?

Answers

Answer:

1. Many fronts cause weather events such as rain, thunderstorms, gusty winds, and tornadoes. At a cold front, there may be dramatic thunderstorms. At a warm front, there may be low stratus clouds. Usually, the skies clear once the front has passed.

2. As the warm moist air rises, towering clouds often form releasing energy in the form of brief, intense rain storms with high winds and lightning. On the other hand, warm fronts will ride up and over cold air near the surface. As it rises, the air cools and the humidity condenses to form clouds and precipitation.

Explanation:

Which layer of the atmosphere has the most air pressure?
stratosphere
mesosphere
troposphere
exosphere

Answers

[tex]troposphere \\ \\ hope \: it \: helps[/tex]

Troposphere is the answer

Some flowers become _______ that contain seeds.
a. Nectar
b. Seeds
c. Trees
d. Fruit

Answers

Answer:

D

Explanation:

Flowers can turn into fruit and that fruit will most likely hold seeds for example strawberries you can see the seeds in the outer skin.

Answer:

Some flowers become ___FRUIT____ that contain seeds.

OPTION D

Explanation:

PLEASE MARK ME AS BRAINLIST PLEASE I

An increase in ATP levels would tend to ____________ the PDH complex. Activate inhibit phosphorylate

Answers

An increase in ATP levels would tend to inhibit the PDH.

The oxidation of pyruvate

After the break down of glucose through the metabolic pathway known as glycolysis, the end product, pyruvate, is converted to acetylChoA in the citric acid cycle.

Pyruvate dehydrogenase (PDH) is the first enzyme of the citric acid cycle that is activated by its substrate pyruvate and inhibited by its products acetylChoA together with Adenosine Triphosphate (ATP).

This means that an increase in ATP negatively regulates the enzyme, pyruvate dehydrogenase.

Therefore, an increase in ATP levels would tend to inhibit the PDH.

Learn more about enzymes here:

https://brainly.com/question/1596855

What system is a long tube that travels through you body? It take me the butriente out of food for you body to use

Answers

Answer:

The broken-down food is then absorbed into the bloodstream from the small intestine and the nutrients are carried to each cell in the body. THE DEGISTIVE TRACT begins at the mouth and ends at the anus. It is like a long muscular tube, up to 10 metres long, with digestive organs attached along the way.

6. List What types of
particles make up a
carbon atom?

Answers

Answer:

The subatomic particles in the nucleus of a carbon atom are protons and neutrons.

Explanation:

The atomic nucleus contains protons and usually neutrons (except for hydrogen-1 (protium) atoms. The number of protons is an element's atomic number and is the same for all atoms of an element. Carbon has atomic number 6. So all atoms of carbon have 6 protons in their atomic nuclei. Carbon atoms also contain neutrons in their atomic nuclei, which may number 6, 7, or 8.

explain how cactus leaves and stems might have changed through the process of natural selection

Answers

Answer:

Leaves were generally lost as a water conservation measure so that transpiration would not drain the cactus of water in its desert environment. Stems grew into large reservoirs to hold any water brought into the cactus.

What is the difference between a mass extinction and a regular (background) extinction? (1 point)
O Mass extinction can be caused by ecological factors like climate change and loss of habitat.
O Mass extinction is ongoing and is a regular process that results from evolution
O Mass extinction occurs over a long period of time.
o Mass extinction involves many species over a short period of geologic time.

Answers

Mass extinction happens when many individuals of a species are lost within a short period while regular extinction happens over a longer period of time.

Mass extinction versus regular extinction

Mass extinction refers to the loss of many species within a short period of time.

Mass extinction can be caused by catastrophic events that result in the destruction of habitats, climate change, extreme temperature change, volcanic eruptions, and so on.

If the loss of species happens over a long period of time, it is no longer considered mass extinction but regular extinction.

More on species extinction can be found here: https://brainly.com/question/13016883

three factors that cause environmental pollution​

Answers

Answer:

Oil,air pollution and soil erosion

sorry if I get it wrong

Answer:

industries , Transportation , Agricultural Activities

Explanation:

Environmental pollution has existed for centuries but only started to be significant following the industrial revolution in the 19th century

The Arctic Desert partially occupies the territory of which country? ​

Answers

Answer:

The ecoregion stretches 2,000 km west-to-east, and 1,000 km north-to-south, across the Arctic Ocean north of Norway and Russia. It covers the island groups of Svalbard (Norway), Franz Josef Land (Russia), Severny Island (Russia), and Severnaya Zemlya (Russia).

Explanation:

relationship between living environment and non living environment. 6point strong​

Answers

Question:

•Relationship between living environment and non living environment.

Answer:

Living things need nonliving things to survive. Without food, water, and air, living things die. Sunlight, shelter, and soil are also important for living things. Living things meet their needs from living and nonliving things in ecosystems.

Explanation:

#Let's Study

#I Hope It's Help

#Keep On Learning

#Carry On Learning

PLEASE HELP I'LL GIVE 40 POINTS

Answers

Carbon Cycle

Are you talking about the carbon cycle

[MA]:

Carbon cycle.

Writer's Note: Sorry if this is wrong, i was never good at things like this.

[xArtsy]

What are 3 thing created by genetic engineering??

Answers

Human growth hormones, monoclonal antibodies and vaccines

list some common structures that are found in both modern birds and Archaeopteryx.

Answers

Common features found in birds and Archaeopteryx include

feathers,three-fingered hands,wishbone

What are birds?

Birds are a group of animals that possess wings and can usually fly.

Birds belongs to the class of animals aves.

Birds are believed to be descendants of the ancient animal called Archaeopteryx.

Some common features found in birds and Archaeopteryx include:

feathers,three-fingered hands,wishbone, and long robust forelimbs.

In conclusion, the modern birds can be said to be a descendant of the Archaeopteryx due to common features shared by them.

Learn more about birds and Archaeopteryx at: https://brainly.com/question/18112936

#SPJ1

Four of the following are important ecological services provided by forests; one is not. Choose the one that is not. Group of answer choices Provides wildlife habitat Stores atmospheric carbon Soil erosion is reduced Recreation Influences local and regional climate

Answers

Forests act as habitats for wildlife, acts as carbon sinks, help reduce soil erosion, and influence local and regional climate.

Forest's ecological services

These are services that forests provide for the biotic component of the ecosystem.

Forests serve a wide variety of services to humans and animals. They act as sinks for carbon, provide habitats for wildlife, provide foods for humans and animals, protect watersheds and soils, among several other services.

Forests are also able to influence local and regional climate due to their ability to serve as sinks for carbon dioxide, a greenhouse gas capable of causing warming.

Forests, however, may not serve recreational purposes, except they are specifically modified to do such.

More on forests can be found here: https://brainly.com/question/21087303

how are viruses different from bacteria

Answers

Answer:

viruses are a non-living collection of molecules that need a host to survive.

bacteria are free-living cells that can live inside or outside a body

Explanation:

How are a desert and a tundra similar? (100 points) BRAINLIEST will be given!



They both have high levels of precipitation.

They have many trees and a lot of vegetation.

They have high average temperatures.

They have low humidity and low levels of precipitation.

Answers

Answer:

they have high average temperatures

Explanation:

:3

what is a chemical bond
1.interactions between atoms that are sharing donating or receiving electrons.
2.a reaction between multiple chemicals
3.the total sum of energy of a persons endergonic and exergonic reactions
4.the rule that states that a full outer shell of an atom contains 8 electrons

Answers

2

Well, a chemical bond is a connection between two surfaces or objects that have been joined together, so it's reasonable that it's 2

What is the phobia of eyes called?

Answers

Answer:

The phobia is called Ommetaphobia.

Explanation:

Ommetaphobia describes an extreme fear of eyes. Like other phobias, this type of fear can be strong enough to interfere with your daily routine and social activities, while also being considered irrational because of the lack of any “real” danger.

3. Identify What metal properties
can you see in this ladder?


i think aluminum and the liquid metal mercury ???

Answers

Answer:

it looks lustrous, malleable and ductile.

Explanation:

When you look at the ladder you can see the metal next to the step looks shiny.  Noticing how the ladder is bent you can tell it is malleable. It also look ductile bc different parts of the metal is thinner than the other.  
Hope this helps!!

organelles in the cytoplasm that contain enzymes that digest proteins.

Answers

Answer:

Lysosomes break down macromolecules into their constituent parts, which are then recycled. These membrane-bound organelles contain a variety of enzymes called hydrolases that can digest proteins, nucleic acids, lipids, and complex sugars. The lumen of a lysosome is more acidic than the cytoplasm.

Write in your own words palagrism will not be tolerated. answer these questions in ur own words.

1. Why is diffusion important for living organisms?

2. Define concentration gradient.

3. What is the effect of concentration gradient on the rate of diffusion?

4. What is the effect of surface area on the rate of diffusion?

Answers

Answer:

1. because it allows them to gain the useful substances they require to obtain energy and grow, and lets them get rid of waste products.

2.The difference in the concentration of a substance between two areas is called the concentration gradient . The bigger the difference, the steeper the concentration gradient and the faster the molecules of a substance will diffuse. The direction of diffusion is said to be 'down' or 'with' the concentration gradient.

3.The greater the difference in concentration, the quicker the rate of diffusion. The higher the temperature, the more kinetic energy the particles will have, so they will move and mix more quickly. The greater the surface area, the faster the rate of diffusion.

4.The greater the surface area, the faster the rate of diffusion.

Explanation:

HOPE IT HELPS

Describe the role of competition in the simulation?

Answers

Answer: Competition ensures the survival of the fittest.

Explanation: The better characteristics and genes can be passed on.

Answer:

Competition can sometimes be viewed as not always necessary in an organisation especially when it comes to training; however I oppose this idea, especially in the context of business simulation games. There are various advantages of creating healthy competition within a business simulation game environment, just like in the real business world:

Explanation:

hope it help
Other Questions
What event determines when a chromatid becomes a chromosome. Questions1. An object travels 3 meters in 1.5 seconds. What is its velocity? 7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA wouldyou see on the electrophoresis gel?BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 33TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5 GIVING BRAINALIST IF CORRECT + LIKESIs the tense correct in the example ?Were vegan our trip right now.A.)Yes B.)No HELP ME NOW!Which is a benefit of dynamic stretching? *increases heart rate increases oxygen and blood flow in the body improves range of motion all of the above Thabo rounded the number to the nearest 5. His answer was 340. Write down 2 possible number for the actual number of marbles In 1950 the ph of the pond water was 8. 2, but by 2000 the ph had decreased to 5. 2. An effective short-term remediation strategy for the pond would be to. The exterior of which American structure issimilar to that of the Pantheon in Rome,revealing the influence of ancient Greeceand Rome during the Neoclassical period inthe United States?O FallingwaterO Thomas Jefferson's MonticelloSolomon A. GuggenheimMuseumGreat Mosque of Cordoba Carter invested $3,900 in an account paying an interest rate of 3. 9% compounded daily. Assuming no deposits or withdrawals are made, how much money, to the nearest hundred dollars, would be in the account after 5 years? what is the capitol of finlad? Need to know If chicken costs 10 per ounce and grain costs 1 per ounce, how many ounces of each should Ruff use in each bag of dog food to minimize cost? Your friend annette complains of chronic heartburn. Which suggestion might be helpful to her?. 26m18m4m39mNeed to find the area of this shape anyone? What would be the effect of using a drug that stops further changes in the cell during G2 phase? What organelle converts food into a form of chemical energy the cells can use?MitochondriaNucleus Endoplasmic reticulumChlorophyll Malaya creates a password as follows: letter, number, letter, special character, number Assuming that there are 12 special characters, if you were trying to guess Malayas password, what is the most guesses that you would have to make? a. 702,000 b. 811,200 c. 205,476,480 d. 254,803,968. Solve the system of equations x - 4y = 7 2x + y = 5HTML EditorKeyboard Shortcuts A dilation with a scale factor of 3. 5 and centered at the origin is applied to PQ with endpoints P(2, 5) and Q(2, 1) Someone help me with this PLEASE HELP ILL GIVE BRAINLIEST Sara is making a cake in a trapezoidpan. The top base is 10 inches, thebottom base is 20 inches and theheight is 5 inches. She wants to coverthe top of the cake with pink frosting.Calculate how much frosting she willneed. Each frosting container covers acake with an area of 25 inches. Howmany containers will she need?A. 1 containerB. 3 ContainersO C. 2 containersOD. 4 containers