Factor 64x2 – 80xy + 25y2 using the binomial theorem.
The binomial that was expanded is .
The exponent on the factored expression is .

Answers

Answer 1

Answer:

Step-by-step explanation:

Factor 64x2 80xy + 25y2 Using The Binomial Theorem.The Binomial That Was Expanded Is .The Exponent On

Related Questions

Which model represents 2.36 divided by 4?

Answers

Answer:

[tex] = \frac{2.36}{4} \\ = \frac{59}{100} \\ = 0.59[/tex]

Identify the constant of Proportionality Write an equation to relate weight, w, to the price, p.

Answers

Answer:

m = .45

p = .45w

______

.45 = 9/20

Explanation:

m is the rate of change equal to the price over the weight or p/w.

Because this relationship is proportional, each weight divided by its corresponding price must equal the same fraction because it is constant.

We can prove this by dividing each price by its weight to find this proportion.

1.35/3 = 2.7/6 = 27/60 = 9/20 = 0.45

1.71/3.8 = 171/380 = 9/20 = 0.45

2.34/5.2 = 234/520 = 117/260 = 9/20 = 0.45.

Since equal the same value, this means that 9/20 or .45 is our proportion.

in terms of p = mw

p/w = 9/20.

p = mw → p/w = m → m = p/w = .45 .

Thus, p = .45w,

so m = .45.

Which means that for every .45 or 9/20 w or weight, there is a price of $1.

The discount price of a hat is $24 whats the regular price if the discount is 20%

Answers

Answer:

30

Step-by-step explanation:

discounting by 20% is the same as marking to 80% of the original cost. 80% = .8

set up equation and solve

.8x=24

x=30

Please help it says im wrong im giving brainliest

Answers

Answer:

ohh

Step-by-step explanation:

Answer:

1:5

Step-by-step explanation:

It is asking you to simplify the ratio, although it gave the unsimplified ratio to you below the diagram.

1/5=3/15

HTH :)

Which statements are true? Select each correct answer.
A ​ −2 ​ is farther from zero on the number line than ​ −1 ​ , so |−2|>|−1| .
B The absolute value of −2 is positive.
C The absolute value of −2 is less than the absolute value of 2.
D Since −2 is 2 units to the left of 0, |−2|=−2 .

Answers

Answer:

A and B

Step-by-step explanation:

(5x + 75)
(3x+ 25)
a. x = 80
b. x = 10
c. X= -25
d.x=25

Answers

Answer:

c. x=-25 is the answer

(5x+75)

- (3x+25 )

=2x +50

×=-25

a) Two cards are dealt off a well-shuffled deck. You win $1 if the two cards are

of different suits. Find the probability of your winning?

b) A coin is tossed 5 times. What is the probability that the first toss is a head

or exactly 2 out of the five tosses are heads?

c) In a shuffled 52-card deck, what is the probability that neither the top nor

the bottom card is a heart?

d) A bag contains 20 red marbles, 20 green marbles and 20 blue marbles. You

reach in and grab 15 marbles. What is the probability that they are all the

same colour?

Answers

Answer:

A.) 0.7647 b.) 13/ 16 C.) 0.9412 D.) 8.743 * 10^-10

Step-by-step explanation:

A)

Number of cards per suit = 13

Nunber of suits = 4

Probability = required outcome / Total possible outcomes

P(1) = probability of picking a card from a certain suit

P(1) = 13 / 52

Hence, probability that 2nd card will be from a suit different from the first :

Total possible outcomes = (52 - 1) = 51

Required outcomes = (13 * 3) = 39

= 39 / 51

= 0.7647

B.)

First toss being head :

Required outcome = H = 1

Total possible outcomes = T or H = 2

P(H) = 1/ 2

For 5 tosses

Total possible outcomes = 2^n = 2^5 = 32

Exactly 2 heads = 10

P(exactly 2 heads) = 10/32 = 5/16

1/2 + 5/16 = (8 + 5) / 16 = 13/16

c)

1 - P(both top and bottom are hearts)

Number of hearts = 13 ; number of cards = 52

P(both are hearts) = 13/52 * 12/51 = 0.05882

1 - 0.05882

= 0.94117

= 0.9412

d)

Either all marbles are red OR all marbles are green OR all marbles are blue

Total number of marbles = (20 + 20 + 20) = 60

Probability that all 15 marbles are of a certain color :

(20/60 * 19/59 * 18/58 * 17/57 * 16/56 * 15/55 * 14/54 * 13/53 * 12/52 * 11/51 * 10/50 * 9/49 * 8/48 * 7/47 * 6/46)

(2.9146E−10) + (2.9146E−10) + (2.9146E−10)

= 8.7438E−10

= 8.743 * 10^-10

What is the value of x??

Answers

Answer:

160

Step-by-step explanation:

Using Exterior angle theorem

30+130=160

x=160
Uhhh not sure if you want the explanation

Tyrone walked 8 miles in a walkathon at a speed of 2 miles per hour. How long was he walking?
4 hours
6 hours
10 hours
16 hours

Answers

Answer:

4 hours

Step-by-step explanation:

Answer:

the answer is 4 HOURS

Step-by-step explanation:

i took the exam

Which expression shows the result of applying the distributive property of 3(2x – 6)?
(NEED ANSWER QUICK!)

52 - 3
20 – 18
62 - 6
6.2 – 18

Answers

Answer:

6x - 18

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Distributive Property

Step-by-step explanation:

Step 1: Define

3(2x - 6)

Step 2: Expand

Distribute 3:                    3(2x) + 3(-6)Multiply:                          6x - 18

Step-by-step explanation:

[tex] \huge3(2x - 6) = 6x - 18[/tex]

(6x-18) is the right answer.

Can someone solve this problem?
[tex]8y - 7 + 7[/tex]
Thank you very much.
Also Hedland gets a shoutout.

Answers

8y -7 + 7

Since two opposites add up to zero , remove them from the expressions
8y

Solution = 8y


Graph 16x−4y=2.Please answer I will make you the brainlist and rate you 5 stars if good.And report if bad.

Answers

Answer:

First one is the graph second one is the equation

Step-by-step explanation:

Hope this helps :)

Answer:

Step-by-step explanation:

as graphed

Help me with this pls!!

Answers

Answer:

5 3/4 hours

Step-by-step explanation:

They drove 3 1/2 hours then  2 1/4 hours. We need to find the total of these to find how long this part of the trip was

(3 + 1/2) + (2 + 1/4) = 5 + 1/2 + 1/4

For 1/2, we can multiply both the numerator and denominator by 2 to get

1/2 = 2/4

Substituting that in, we get

5 + 2/4 + 1/4

= 5 + 3/4 hours

Two pounds of grapes cost $6. How many pounds of grapes cost $1? *

Answers

Step-by-step explanation:

Answer:

1/4

Step-by-step explanation:

Tis will be your answer :D

Someone help please?

Answers

Answer:

the answer i H.

Step-by-step explanation:

you just multiply the numbers and get -77.625 which simplifies to -77 5/8

Armando is baking 36 batches of brownies for the bake sale. Each batch of
browries takes 1 1/15
cups of flour. What is a reasonable estimate of the
amount of flour that he will need to bake all thirty-six batches of brownies?

A.18

B.36

C.39

D.72

Answers

Answer:

apple

Step-by-step explanation:

Help me i'll help you back

Answers

Answer:

A, C, B, respectively

Step-by-step explanation:

science(density and buoyancy)

When Jose woke up the temperature was 74°. It

reached a high temperature of 91°. What was

the percent of increase of these temperatures?

Answers

Answer:

22.97

Step-by-step explanation:

Given that,

Initial temperature = 74°

After some time, the new temperature = 91°

We need to find the percent increase in the temperature.

The formula for the percentage increase is given by :

[tex]\%=\dfrac{|\text{final value-initial value}|}{\text{initial value}}\times 100\\\\=\dfrac{91-74}{74}\times100\\\\=22.97\%[/tex]

So, the increase in temperature is 22.97%.

The top of a 25-foot ladder is sliding down a wall at a rate of 3 feet per second. When the top of the ladder is 15 feet from the ground, what is the rate of change between the bottom of the ladder and the wall?

Answers

Answer:

1.8ft/s

Step-by-step explanation:

Using the formula for calculating Speed as shown:

Speed = Distance/Time

Time = Distance/Speed

t = d/s

Given

d1 = 25 foot

s1 = 3ft/s

d2 = 15ft

Required

s2

Using the formula;

d1/s1 = d2/s2

s2 = s1d2/d1

s2 = 3*15/25

s2 = 45/25

s2 = 1.8ft/s

Hence the rate of change between the bottom of the ladder and the wall is 1.8ft/s

Nancy and Linda go to their favorite restaurant. Nancy has a $5 off coupon to use for her purchase of $30. Linda has a 10% off coupon to use for her purchase of $25. What is the difference between the total the friends will pay individually

Answers

Answer:

Step-by-step explanation:

2.50

The percentage is calculated by dividing the required value by the total value and multiplying it by 100.

If Nancy has to buy an item that cost $30 with a 5% off and Ninda has to buy an item that cost $25 with a 10% off.

The difference between individual pay is $6.

What is a percentage?

The percentage is calculated by dividing the required value by the total value and multiplying it by 100.

Example:

Required percentage value = a

total value = b

Percentage = a/b x 100

We have,

Nancy:

Coupon = 5% off

Cost of the purchase = $30

Amount to pay:

= 30 - (5/100) x 30

= 30 - 30/20

= 30 - 1.5

= $28.5

Linda:

Coupon = 10% off

Cost of the purchase = $25

Amount to pay:

= 25 - (10/100) x 25

= 25 - 2.5

= $22.5

The difference between individual pay:

= 28.5 - 22.5

= $6

Thus

The difference between individual pay is $6.

Learn more about percentages here:

https://brainly.com/question/11403063

#SPJ6

Does the graph in Exercise 33 have a Hamilton path? If

so, find such a path. If it does not, give an argument to

show why no such path exist​

Answers

;

Answer:

there is a graph first step to but I cannot draw it on here but you already have your answer without Step 2

Step-by-step explanation:

a simple path in a graph G that passes through every vertex exactly once is called a path . the graph G has no past because any past containing all vertices must contain one of the edges (e, c) (d, f ) and (B, G) move than once .

Can someone help me please!!

Answers

9514 1404 393

Answer:

  AE = CE = 23; BE = DE = 20

Step-by-step explanation:

Put the values of the variables in their place and do the arithmetic.

  AE = 2u+5 = 2(9) +5 = 23

  BE = 6v-1 = 6(3.5) -1 = 20

  CE = 3u-4 = 3(9) -4 = 23

  DE = 8v-8 = 8(3.5) -8 = 20

The diagonals cross at their midpoints, so the quadrilateral is a parallelogram.

If z>0, what is the quotient of 20√z6 ÷ √16z7 in simplest radical form

Answers

Answer:

5√z/z

Step-by-step explanation:

i took the test(:

The quotient of [tex]20\sqrt{z^{6} }[/tex] ÷ [tex]\sqrt{16z^{7} }[/tex] in simplest radical form is  [tex]\frac{5\sqrt{z} }{z}[/tex].

How to express a simplest radical form?

Expressing in simplest radical form just means simplifying a radical so that there are no more square roots, cube roots, 4th roots, etc left to find. It also means removing any radicals in the denominator of a fraction.

Given

[tex]20\sqrt{z^{6} }[/tex] ÷ [tex]\sqrt{16z^{7} }[/tex]

Rewrite as fraction: [tex]\frac{20\sqrt{z^{6} } }{\sqrt{16z^{7} } }[/tex]

Factor and rewrite the radicand in exponential form: [tex]\frac{20\sqrt{z^{6} } }{\sqrt{4^{2}. z^{6} .z} }[/tex]

Rewrite the expression using [tex]\sqrt[n]{ab} =\sqrt[n]{a} \sqrt[n]{b}[/tex] :

= [tex]\frac{20\sqrt{z^{6} } }{\sqrt{4^{2} .\sqrt{z^{6}.\sqrt{z} } } }[/tex]

Simply the radical expression, we get:

= [tex]\frac{20z^{3} }{4z^{3}\sqrt{z} }[/tex]

Reduce fraction to the lowest term by canceling the greater common factor, we get

= [tex]\frac{5}{\sqrt{z} }[/tex]

Rationalize the denominator

= [tex]\frac{5\sqrt{z} }{\sqrt{z} .\sqrt{z} }[/tex]

= [tex]\frac{5\sqrt{z} }{z}[/tex]

Hence, the quotient of [tex]20\sqrt{z^{6} }[/tex] ÷ [tex]\sqrt{16z^{7} }[/tex] in simplest radical form is  [tex]\frac{5\sqrt{z} }{z}[/tex].

Find out more information about simplest radical form here

https://brainly.com/question/12966955

#SPJ3

What’s 65+56+4+-4
;)

Answers

Answer:

119

Step-by-step explanation:

PLEASE HELP RIGHT ANSWERS ONLY NO PLAYING AROUND

Answers

Answer:

the boxes to the left should say 2 and and 10 and the box to the right should be 18

Step-by-step explanation:

You are running a concession stand at a basketball game. You are selling hot dogs and
sodas.Each hot dog costs $1.50 and each soda costs $ 0.50. At the end of the night, you made a total of
$78.50. You sold a total of 87 hot dogs and sodas combined. You musſt report the number of hot dogs
sold and the number of sodas sold. How many hot dogs were sold and how many sodas were sold?

Answers

Answer: 52

Step-by-step explanation: Friend me and yes that is right!

Slope of the line that passes through (6,0) and (0,-6)

Answers

Hey there!

The formula is:

• m = rise / run

• m = y₂ – y₁ / x₂ – x₁

• y₂ = –6

• y₁ = 0

• x₂ = 0

• x₁ = 6

• Equation: “–6 – 0 / 0 – 6”

–6 – 0 = –6 ⬅️ numerator (TOP number)

0 – 6 = –6 ⬅️ denominator (BOTTOM number)

Equation: –6 / –6

SOLVE above and you will have your ANSWER.

–6 / –6 = 1 because double negatives makes a negative.

The slope of line that passes through your given points is: 1

Answer: 1 ☑️

Good luck on your assignment and enjoy your day!

~LoveYourselfFirst:)

PLEASE ANSWER ASAP FOR BRANLEST!!!!!!!!!!!!!!!
Solve the equation
-15 = 8z + 7
what is z?

Answers

Answer:

-2.75

Step-by-step explanation:

Subtract 7 by both sides to get -22 = 8z. Divide 8 on both sides. You get -2.75

if a bike race covers 120 mi over 6 days and the cyclists ride the same distance every day how many miles does each cyclist ride each day​

Answers

120/6= 20
they ride 20 miles each day

Algebraic Expression
43 times greater than
the sum of 57 and 93​

Answers

The algebraic expression is the following

43(57+93)

You’re going to want to put into parentheses the numbers 57 and 93 anytime you are asked for the sum of two numbers. Of course you would want to complete that portion of the algebraic expression first (PEMDAS) then you would want multiply that by 43 to make it 43 times greater.

43(150)

The final answer to the expression is 6,450
Other Questions
A new bridge has a weight limit of 3 tons, tiene car weighs 7,900 lbs. Will the besble to drive hercare across the bridge, explain why or why not what's the perimeter of a triangle with sides 2 inches, 3 inches, and 4 inches in length? what tress does hemlock woolly adelgid affect? When Georgions on the home front read about the Pacific Theater during World War II, they were reading about thegoal of defeatingGermanyJapanChinaItaly Which of the following are adjacent angles? I need help!!!!!!!!!!!!!!!!!!!!!!!!!!!! :) Three (3) movie tickets cost $36. At this rate, what is the cost perticket?O $18$33O $12O $108 Select the correct answer.Susan is planning to create a vector mask for an image. What editing tools can Susan use to create a vector mask? .a Pen tool or a Shape toolOB.a Painting tool or a Select toolOC.a Dodge tool or a Burn toolOD.a Type tool or a Type Mask tool What would be the final step to applying your customized voting butons in Outlook messages?O Type your new choices in the Text Bar.O Click on Voting Buttons and choose Custom.O Open the Voting Buttons menu and choose your customized choices.O Click Submit and your custom voting choices will appear in the message body. 320 grams of brass released 5000 J of heat. If it has an initial temperature of 50C, what is its temperature after releasing the heat? The specific heat capacity of brass is 376 J/kg. * Harvesting wood from forests is one the top industries in the world. There are various ways for loggers to harvest this wood. Which of the following would provide the best sustainable use of the land?A. Strip cutting the trees because only mature trees are cutB. Clear cutting the trees because it is the most cost effective methodC. Clear cutting the trees because it produces the greatest timber yieldD. Strip cutting the trees because it minimizes widespread destruction decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA Read the conclusion from the Declaration of Sentiments. Then, answer the question.1What is Elizabeth Cady Stanton demanding?2She wants women to become US citizens.3She wants women to have special privileges.She wants women to have all the rights they are due as US citizens.In view of the unjust laws above mentioned . . . we insist that [women] have immediate admission to all the rights and privileges which belong to them as citizens of the United States.- Declaration of Sentiments1848 According to sea wolf which quotation from the excerpt most clearly helps to build tension by portraying an external conflict Please help me plot this True or False: The moon does not have anatmosphere, plants, animals or oceans. 30 POINTS!!!! As you read the paragraph below, decide how relevant each detail is.The two rowers carefully held both sides of the boat. One at a time each rower climbed into the boat and sat in her seat. When both rowers were in place, they grabbed the oars beside them. The oars were long and made of wood. The rowers pushed away from the dock.Which fact above is the least relevant?Select one:a.When both rowers were in place, they grabbed the oar beside them.b.The oars were long and made of wood.c.One at a time each got on and sat in their seat.d.The two rowers carefully held both sides of the boat. What are some similes and metaphors from "The Polar Express"? 163-x=-52 equals what as the answer Notre Dame Cathedral located in Paris, France is most closely associated with-A) HinduismB) JudaismC) BuddhismD) Christianity