Given f(x) = x2 + 7x and g(x) = x4, choose
the expression for (fºg)(x).

Given F(x) = X2 + 7x And G(x) = X4, Choosethe Expression For (fg)(x).

Answers

Answer 1

Answer:

f(x4)=x8+7x4

Step-by-step explanation:

not a 100% sure tho


Related Questions

I need help answering this. Could someone please explain to me step by step how to do this thank you very much.​

Answers

Hope it can help you and please mark me as a brainlist..

f(x)=2x-3, solve when x=0,-1,2
answers
A-3, -1,1
B-3,-5,1
C3,-1,1
D-3,-1,7

Answers

Answer:

b

Step-by-step explanation:

help asap please??????

Answers

Answer:

5x-16=4x+34

-4x    -4x

1x-16=34

+16 +16

1x=50

x=50

Please help if you can

Answers

Answer:

J=130

Step-by-step explanation:

180-90-40=50

180-50=130

somebody start a conversation w me and ill mark brainliest

Answers

Answer:

wanna be friends

Step-by-step explanation:

Gustav is starting a special sprinting regimen in outdoor track. The regimen suggests sprinting for a certain number of seconds, sss, at first. The second time he sprints, he should run 150 more seconds than the first time. For the third time, the regimen suggests sprinting twice the number of seconds as the first time. Finally, the regimen suggests an 80-second sprint. Which of the following functions can be used to find the total number of seconds, t, suggested by the entire sprinting regimen?

a. t=s+230
b. t=2s+230
c. t=5/2s+230
d. t=4s+230

Answers

Answer: d. t = 4s + 230

Step-by-step explanation: In the first part of his regimen, Gustav sprints for a time of s seconds:

part 1: t₁ = s

In the second part, time is 150 more seconds than first part:

part 2: t₂ = s + 150

In part 3, time is twice the number as the first time:

part 3: t₃ = 2s

And in the last part, the regimen is of an 80 second sprint:

part 4: t₄ = 80

Th entire regimen has a total of seconds equal to

[tex]t=t_{1}+t_{2}+t_{3}+t_{4}[/tex]

t = s + s + 150 + 2s = 80

t = 4s + 230

The function which represents the total number of seconds suggest by the entire regimen is t = 4s + 230

someone please help me

Answers

Answer:

[tex]g(x)=2^{x+7}-1[/tex]

Step-by-step explanation:

Recall that horizontal shift to the left in 7 units is obtained by adding 7 to the x variable in the function's expression. Then the transformation should be:

[tex]g(x)=2^{x+7}-1[/tex]

[16 pts please help]

DRAG THE TILES

Fran, Robert, and Becky all got summer jobs. Fran earned $140 for 20 hours of work, Robert earned $150 for 25 hours of work, and Becky earned $120 for 15 hours of work.


Sequence the three workers in order from least amount of money earned per hour to greatest amount of money earned per hour.


Fran

Robert

Becky

Answers

Answer:

Becky, Fran, Robert

Step-by-step explanation:

Fran: 140 ÷ 20 = 7

Robert: 150 ÷ 25 = 6

Becky: 120 ÷ 15 = 8

Pls hurry I need an answer!!!

Answers

Answer:

133 degrees

Step-by-step explanation:

if FBE is 47 degrees and is identical to angle CBD, then we can consider

EBD as 180 degrees first and subtract 47 degrees, which is 133 degrees, that is how I got my answer.

hope it helped in any way.

(2x2 + x - 10) = (x - 2)

Answers

Answer:

8

Step-by-step explanation:

i think but Good Luck:D

Need help ASAP due in 7 minutes
Will make you brainlist

Answers

Answer:

A

Step-by-step explanation:

A is the only answer with ordered pairs that have a consistent rate of change, -1/3

Please help I will give BRAINLIST I’m exhausted

Answers

Step-by-step explanation:

hope it's helpful ❤❤❤

THANK YOU

Pls help extra points and mark brainlist

Answers

Answer:

tina has 6 and Juan has 9

Step-by-step explanation:

4+2=6 and 6+3=9

HELP!!! PLEASE!!!!

Write the standard form of the quadratic equation modeled by the points shown in the table below.

Answers

Answer:

y = 2x² - 5x + 7

Step-by-step explanation:

For this problem, imagine the standard form, which is:

f(x) = ax² + bx + c = y

Using the table, and adding that y at the end, we can plug in and write out the following equations. (Writing it out is important):

f(-1) = a(-1)² + b(-1) + c = 14

f(0) = a(0)² + b(0) + c = 7

f(1) = a(1)² + b(1) + c = 4

f(2) = a(2)² + b(2) + c = 5

Now if this doesn't look familiar, it's actually a systems of equations using the a, b, and c elements as your three variables! If you simplify the equations:

f(-1) = a - b + c = 14

f(0) = c = 7

f(1) = a + b + c = 4

f(2) = 4a + 2b + c = 5

Something unique just happened. We have already defined what ' c ' is!

c = 7

Setting that aside, if you remove the f(x) portion of the equations, you're left with:

a - b + c = 14

a + b + c = 4

4a + 2b + c = 5

Using the two upper equations, if we add them together (you can do that as it doesn't change the values of the variables) you get:

2a + 2c = 18

Note: the ' b ' variables cancelled out in the addition [ b +  (-b) ]

If you further simplify the equation:

a + c = 9

Awesome. Now we already know that c = 7, so if you plug that into the equation:

a + 7 = 9

Solve for a. So then a = 2

Now that we know the following:

a = 2

c = 7

We can then use the equation:

a + b + c = 4

And solve for b!

2 + b + 7 = 4

Simplify.

b + 9 = 4

Simplify.

b = -5

Now at this point, since you know what a, b and c are, you can write the equation!

f(x) = 2x² - 5x + 7

You can confirm your work by putting any of the x values in the table through!

2556 25
5625/25

How do you divide 5625 by 25?

Answers

Answer:112.5

Step-by-step explanation:

brainliest oh and sub to my yt for rocket league vid IDRXPD UP on yt.

Answer:

Step-by-step explanation:

You do 5625 / 25 like this: For each step you multiply 25 by the highest number possible in the first 2 numbers. So if it was 27 / 9  you would find how many times 9 can fit into 27 but since the number 5625 is not one of the first 10 multiples of 25 you see the first 2 numbers and if you still can't divide you combine the next value. The top number is the answer.

Use the graph to determine the function's domain and range.
10
8-
6
-10-8-6
4
2
00
41
-6-
101
Find the domain and range

Answers

Answer:

get to know if u want me to come back to now 5ah I love you too baby

Select the number that would make this statement true: 719.3 ÷ ________ = 7.193

1
10
100
1,000

Answers

100
When you divided by 100 is should be 7.193

Liliana read two books in three months. What was her rate of reading, in books per month? Give your answer as a whole number or a fraction in simplest form

Answers

Answer:

two thirds

Step-by-step explanation:

2 books in 3 months is
2/3

Can someone explain to me what this is asking? I’m so confused on how you show the domain

Answers

Answer:

should be B.

Step-by-step explanation:

When it has a underline it usually means that its a solid circle.

Which of the following numbers round to 530 if we're rounding to the nearest ten?
(Look at the picture)

Answers

Answer:

A and C

Step-by-step explanation:

N/A

If 3 builders can build 15 dog house in a day how many could 5 builders mak​

Answers

Answer:

25

Step-by-step explanation:

First I would divide 15 by 3 which would get me 5 then i would multiply it by 5 to get the answer of 25.

C = V + 13
The variable v represents the number of visits to the history museum, and the variable c
represents the total cost of those visits. What is the maximum number of visits a member of
the history museum can make for a total cost of $19?

Answers

$21 , thank me later

$2.79 markdown 35% what is the answer?

Answers

Answer:

about 1.81

Step-by-step explanation:

Answer:

1.81?

Step-by-step explanation:

1/3 divided by 4 is? (In its simplest form and in a fraction) 13 points!​

Answers

Answer:

1/12

Step-by-step explanation:

Given the following mathematical expression;

[tex]\frac{\frac{1}{3}}{4}[/tex]

We would apply the law of indices for fractions.

1/3/(4) = 1/3 * 1/4 = 1/12

The solution is : 1/3 divided by 4 is 1/12.

Here, we have,

given that,

1/3 divided by 4

Given the following mathematical expression;

1/3 /  4

We would apply the law of indices for fractions.

1/3/(4)

= 1/3 * 1/4

=1/ 3*4

= 1/12

Hence, The solution is : 1/3 divided by 4 is 1/12.

To learn more on division click:

brainly.com/question/21416852

#SPJ6

Find a sum equivalent to 10(y + x)

Answers

Answer: 10x + 10y

8)

Step-by-step explanation:

If I roll two six-sides dice, what is the probability that the sum of the numbers that show up on the dice is 3 or less?

Answers

Answer:

1/12

Step-by-step explanation:

first we have to find all the possibilities of getting a sum of 3 or less: 1+1 or 1+2 and we count the second combination 2 times because the numbers can be on either of the dices so we have a total of 3 possibilities. all the possible pairimg of dice are 6*6=36 because each dice has 6 sides and we can get either of them. so the probability would be the chance of getting a sum of 3 or less divided by all the diff combination which equals 3/36 or 1/12 which is roughly around 8.3%

What kind of checking accounts does Chase Bank offer

Answers

Chase bank offers a bank checking account

2/5 divided by 3 in its simplest form in a fraction is?​

Answers

Answer:

2/15

Step-by-step explanation:

Reduce the expression, if possible, by cancelling the common factors.

The equivalent value of the fraction is A = 2/15

Given data ,

Let the equation be represented as A

Now , the value of A is

Let the first fraction be p

Let the second fraction be q

Now , A = p/q

when the value of p = 2/5

And , when the value of q = 3

On simplifying the equation , we get

A = ( 2/5 ) / 3

So , the left hand side of the equation is equated to the right hand side by the value of ( 2/5 ) / 3

A = ( 2/5 ) / 3

A = ( 2/5 ) ( 1/3 )

On simplifying , we get

A = 2/15

A = 0.133333

Therefore , the value of A = 2/15 = 0.133333

Hence , the fraction is A = 2/15

To learn more about fractions click :

https://brainly.com/question/29766013

#SPJ6

I need help on question four just that one please ASAP! please and thank you! Hope you have a wonderful day and blessed one!

Answers

Answer:

the answer to your question is C: 9.675

the scale drawing of a park uses the scale 5 cm= 1 km. what is the perimeter of the actual park?​

Answers

Answer:5.0 × 10-5

Step-by-step explanation:

5 cm divided by 1 km

Other Questions
The wavelength of a particular wave on the ocean is 5 meters. Thewave travels at a velocity of 10 m/s.What is the frequency of this water wave in Hertz? janet earns $16 per week for doing chores around the house. write and solve an equation that determines how many weeks she needs to do chores to earn $12 According to NASA, an average of one cataloged piece of space debris has fallen back to Earth each day for the past 50 years. Suppose that there is an 11.5% chance that a piece of debris will fall in Russia during a given week, and a 6.7% chance that a piece of debris will fall in Canada during the same week. Which is the most likely Answer These two questions...... I need help asappp plzzzzz I need help filling in the squares for the top and bottom punnet square someone help me plss Tiana deposited $500 into an account that earns 6% simple interest. How many years will it take for the value of the account to reach $2,000? (HELP PLEASE) As part of the science experiment a student observes the growth of a population of bacteria and four different media the table below that stops or visions the student made in which media can the change in the population of bacteria be modeled by a linear function. someone help please... find the commission.earning CommissionSales Commision Rate Commission$6807%?The commission is $ in thank you ma'am when ms jones and roger arrive at ms jones house what does roger do ? I need help to find the Area HELP I WILL mark brainliest Help please due at 9:40 When making a book cover, Anwar adds an additional 20 square inches to the surface area to allow for overlap. How many square inches of paper will Anwar use to make a book cover for a book 11 inches long, 8 inches wide, and 1 inch high? Biologists studying horseshoe crabs want to estimate the percent of crabs in a certain area that are longer than 35 centimeters. The biologists will select a random sample of crabs to measure.Which of the following is the most appropriate method to use for such an estimate?A. A one-sample z-interval for a population proportionB. A one-sample z-interval for a sample proportionC. A two-sample z-interval for a population proportionD. A two-sample z-interval for a difference between population proportionsE. A two-sample z-interval for a difference between sample proportions Use the following data to answer the questions that follow:Cameroon TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAATTsavoTTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAATCGCCTCCTCAAATFannie Roberts TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATSabi Sands TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTGAAATUmfolozi TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATZimbabwe TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATZambiaTTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATKalahari TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATBotswana TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAATEtoshaTTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT5) What question can the data above help to answer? Write your question here: Which one of the following is a truestatement?Percentage earned at the end of this courseis a one-to-one function of SFU studentnumber.SFU student number is a one-to-one functionof percentage earned at the end of thiscourse.Percentage earned at the end of this courseis a function of SFU student number, but it isnot one-to-one.SFU student number is a function ofpercentage earned at the end of this course,but it is not one-to-one. 493 times 5 minus 76Also if any of you watch impractical jokers who is your favorite Which of the four civilizations emerged first?