How are chromosomes affected by aging

Answers

Answer 1

Answer:

delaying cell senescence, apoptosis, and death

Explanation:

Answer 2

Answer:

the enzyme telomerase adds specific DNA sequence repeats to the chromosome ends that are lost through cell division, thus restoring telomere length and delaying cell senescence, apoptosis, and death

Explanation:


Related Questions

In the diagram which of the following is the secondary consumer
The caterpillar
The Snake
The Leaf
The Mongoose

Answers

the answer is the chameleon

Answer:

THE ANSWER IS THE SNAKE

Explanation:

PLEASE MARK ME AS BRAINLIEST

9. The Sun's outward pressure of radiation is balanced by an inward pressure provided by
gravity
O fusion
fission
oxidation

Answers

Im pretty sure is fusion correct me if im wrong

together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?​.​

Answers

Answer: The spread of Christianity among the Jews was the heroic act of San Vitores.

Explanation:

He was murdered on the island of Guam on 2 April 1672. He brought Christianity to the CHamoru people. He was killed  by the chief's daughter Mata' pang with a sword. His conversion efforts were commendable. The CHamorus people  welcomed San Vitores and hundreds of people were readily converted into Christians readily. Today Catholism is the main religion in Guam.

(04.02 LC)
What is a genetically modified organism? (2 points)

Answers

Answer:

organism whose genetic material has been altered so do not have pure natural genome.

What is the relationship between a person's PULSE RATE and his or her HEART BEAT? A. The heart beat is always double the pulse rate. B. The heart beat and pulse rate may change, but are always equal. C. The heart beat is always half of the pulse rate. D. There is no relationship between the heart beat and the pulse rate.

Answers

Answer:

B. The heart beat and pulse rate may change, but are always equal.

Hope this helps :D Have a fantastic day

how has selective breeding contributed to a wide variety of dog breeds?​

Answers

Answer:

In the same way that inbreeding among human populations can increase the frequency of normally rare genes that cause diseases, the selective breeding that created the hundreds of modern dog breeds has put purebred dogs at risk for a large number of health problems, affecting both body and behavior.

What change to the following molecule's structure would result in a saturated fat?

Answers

Answer:

It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.  

Explanation:

Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.

Hope this helped :)  

how do gray whales migrate?

Answers

Answer:  Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.

Explanation:

Identify the labeled structures.
A: B: C: D: E:
The multiple questions are the same for each question. Please help!

Answers

Answer:

e cell wall that is the only one I am sure of because I can hardly see the rest

Which pair of waves could overlap to produce a wave with a higher amplitude through interference?​

Answers

Answer:

D: Two waves of the same amplitude with crests that are perfectly aligned

Explanation:

A P E X

Which chemical bond most likely stores the most energy?
A. C=C
B. C-C
C. H-H
D. H-O

Answers

Answer:

The chemical bond which stores more energy is the Double carbon-carbon bond.

Explanation:

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

please help me!! 15 points!

Answers

More fossils found were of larger oranisms than of dinosaurs

Lloyds lab partner is looking down into a test tube while he hears the contents by using a flame. Which action should Lloyd recommend to his partner if heating must continue?

Answers

Answer:

To stop looking throught the test tube. lol

Explanation:

The annual cost of snow removal for streets and highways in the U.S.
is estimated to be about how much?
O $20 billion
$20 million
$2 billion
O $2 million

Answers

While many homeowners shovel snow themselves, some sign an annual snow removal contract. Highly rated snow removal contractors say customers who sign a contract. annual snow removal contracts in 2013 reported paying an average of $378, million 4 years ago.

State tax revenues in December and January fell far short. projected increases in outstanding debt and annual debt service. year and SFY 2019-20 by a total of nearly $2 billion. The initial Executive Budget proposed using $500 million of the U.S. economy, as of the end of 2018, was in.

For nearly 20 years, the American Society of Civil Engineers has been on average, there were 188 million trips across a structurally deficient. ASCE analysis of U.S. Department of Transportation, Federal Highway assistance and may finance over $2 billion in water infrastructure investment.

These are all from different things, hope one of them helped!! (but if they didnt, super sorry!)

The annual cost of snow removal for streets and highways is estimated to be $2 billion.

A report from the environmental department in one of the universities in the United States gave an estimation of 2.3 million dollars as what is spent yearly to get snow and ice off the streets and highway.

Snow removal is simply an action that is undertaken to get snow off the streets or road after it snowed for safe and easy movement of people.

In conclusion it is estimated to be about $2 billion dollars given 2.3 billion dollars is around this figure.

https://brainly.com/question/810446?referrer=searchResults

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

When the dry and wet bulb temperatures are far apart. the humidity is high.
True
False

Answers

the answer is false purrr

what is the relationship between size and complexity?

Answers

Answer:

"The relational complexity in small groups increases rapidly with small increases in size." a greater rate than does the size of the group." forms of communication," to establish the importance of the concept of organizational com- plexity to the size relationship.

NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?

2.How do you think that the one species of finch evolved into many different species, each with its own advantages?

3. In what ways do these advantages help the finches to survive and reproduce?

4. What might have happened if the finches didn't evolve into many different species?

Answers

Answer:

1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.

2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection

3.  Medium ground finches with larger beaks could take advantage of alternate food

4. three species of Darwin's tree finches have been known to inhabit Floreana  but no birds singing that song on Floreana have been heard in many years.

Explanation:

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

A body cell has been growing and synthesizing proteins. In the nucleus of this body cell, DNA replication is taking place, and a copy of the cell's genetic material is copied. Which of the following is the best conclusion you can make about the life cycle of this cell?

Answers

The best conclusion you can make about the life cycle of this cell is that the cell is in the S phase of interphase and will move next to the G2 phase.

S phase (Synthesis Phase) is the phase of the cell cycle in which all of the chromosomes (DNA) are replicated within the nucleus. During this phase, the DNA is effectively doubled as each chromosome contains two sister chromatids. After the S phase, the cell enters the G2 phase where various proteins (such as microtubules) are synthesized.

The more a muscle is stimulated (working), the smaller it will get.
O
true
О
false

Answers

Answer: true

Explanation: Sometimes, a subset of muscle fibers is activated, depending on how much force is needed. When the muscle is stimulated, calcium ions are released from its store inside the sarcoplasmic reticulum, into the sarcoplasm (muscle ). ... The SR is smaller and less elaborate, and stores less calcium ions.

Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.

Answers

Answer:

genes are segments of chromosomes that form tight coils called dna

The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:

Genes are segments of chromosomes that form tight coils called DNA.

Thus, the correct option is D.

What is Chromosome?

A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.

Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.

Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.

All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.

Therefore, the correct option for this question is D.

To learn more about Chromosomes, refer to the link:

https://brainly.com/question/11912112

#SPJ6

Which of these variables might affect the amount of solar
energy reaching a particular place on Earth's surface?
A. latitude
B. tilt of Earth's axis
C. time of day
D. weather conditions, such as cloud cover

Answers

Answer:

B. tilt of Earth's axis.

Explanation:

Solar radiation, or insolation, is the “fuel” of all solar energy systems. The performance of solar photovoltaic systems which generate electricity and solar thermal systems which produce hot water all depend on the availability and intensity of solar radiation.

Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?

Answers

Answer: The basic answer could be because of the tectonics plates.

Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.

Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.

Why are rocks folded?

Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.

Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.

Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.

Learn more about rocks, here:

https://brainly.com/question/29561452

#SPJ2

Organs are comprised of tissues that work together to perform a specific bodily function. true or false?

Answers

Answer:

I do believe that is true.

Explanation:

The answer is true.

LI:
The diagram below compares the relative diameters of two planets in our solar system.
Which two planets have diameters that most closely resemble this comparison?
1.
Uranus and Neptune
2.
Jupiter and Saturn
3
Earth and Mars
4.
Mercury and Venus
Submit Answer

Answers

Answer:

1, uranus and neptune

Explanation:

i just did it

Based on the diagram above, the two planets having diameters that most closely resemble this comparison are: 1.  Uranus and Neptune.

A solar system is an astronomical system which comprises both the inner and outer planets alongside celestial bodies such as a Moon, that are typically in orbit (traveling) around the Sun in slightly elliptical orbits..  

Basically, the nine (9) planets that are found in the solar system orbiting around the sun include;

Mercury. Venus. Earth. Mars.Jupiter.Saturn.Uranus.Neptune.Pluto.

Generally, the planets found in the solar system vary considerably in terms of shape and size as shown below:

1.  Uranus and Neptune: the mean diameter of Uranus is 50,724 km (31,518.43 mi) while that of Neptune is 49,244 km (30598.8 mi).

2. Jupiter and Saturn: the mean diameter of Jupiter is 142,984 km (88,846 mi) while that of Saturn is 120,536 km (74897.6 mi).

3. Earth and Mars: the mean diameter of Earth is 12,756 km (7926 mi) while that of Mars is 6779 km (4212.275 mi).

4. Mercury and Venus: the mean diameter of Mercury is 4,879 km (3031.67 mi) while that of Venus is 12,104 km (7521 mi).

From the above data on diameter, we can deduce that both Uranus and Neptune are mostly related in terms of size as depicted in the diagram, by using two (2) circles of equal sizes.

Read more: https://brainly.com/question/1251115

What is carbon dioxide​

Answers

Answer:

Carbon dioxide is a colorless gas with a density about 53% higher than that of dry air. Carbon dioxide molecules consist of a carbon atom covalently double bonded to two oxygen atoms. It occurs naturally in Earth's atmosphere as a trace gas.

Answer:

The air that you breathe out. Also it is what plants breathe in.

Explanation:

Hope this helps!!

The cell part that helps with cell division is the ________​

Answers

Answer:

centrioles

Explanation:

Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.

What is meant by a "catastrophic reaction" relating to a person with dementia ?

Answers

Answer:

A catastrophic reaction is an excessive reaction to something that may seem inconsequential to the in-home caregiver. The cause of a catastrophic reaction can be a number of things—the person with dementia simply may not be feeling well or might be feeling rushed and confused.

Other Questions
Bananas cost $1 for 3 pounds. How much for 1 pound? i would like some help pls so pls hurry A company that makes hair products had 9000 people try new shampoo of the 9000 people 72 had a mild allergic reaction what percent of the people had a mild allergic reaction HELP ME ASAP PLEASE TIMED A. A PULLB. COMPRESSIONC. FOLDINGD. A STRONG STRUCTURE Alex drove 372 miles on I-95 and used 12 gallons of gasoline. How many miles did Alexs car travel per gallon of gasoline? What are some of the benefits and drawbacks of plastic? Use in your own words. (4,15) (8,9) find the slope The endocrine system consists of the bodies blank Please Help! Its due today! Properties of immunoglobulin M When does Algal Bloom occur? Two pounds of grapes cost $6. How much does it cost for 5 pounds of grapes Bro help me Explain how an object with a higher temperature can have less thermal energy than an object with a lower temperature. ASAP Please help!! Why is sin(20) = sin(160) = -sin(200) = -sin(340)? Which sentence option correctly uses a semicolon? O A. Marcus decided to quickly check on Soo she lives just across the street. O B. Marcus, decided to quickly check on Soo she lives just across the street. O C. Marcus decided to quickly check on Soo she lives; just across the street. O D. Marcus decided to quickly check on Soo; she lives just across the street. What is x?25.12 = 27.10PLEASE HELP MEEEE How is Blood pressure recorded? Write the untit rate rounded to the nearest hundredth ( two decimal places ) A coffee shop sold 48 cups of coffee in 4 hours how many cups do they sell per hr SOMEONE PLEASE HELP ME!