Answer:
This cumbersome trait significantly decreases the male's chances of survival. ... natural selection: that is, that organisms better adapted to their environment would benefit from ... the individual's reproductive success, even at the expense of their survival (Darwin 1871). ... A successful male can potentially sire many offspring.
Explanation:
The beneficial trait increase the survival and potential reproductive success of the organism as they help organism to thrive in their unfavorable changing environment.
Natural selectionThe natural selection can be defined as the differential survival and reproduction of those organisms which have beneficial traits over others.For example, the color change in chameleon helps them to remain undetected from predator population as well as from prey so it helps in increase in rate of survival of chameleon also helps them to reproduce and increase in number.Hence, beneficial traits increase the rate of survival and reproduction of organisms.
Learn more about natural selection:
https://brainly.com/question/9830102
Help me please. Due today.
Answer:
Okay! I will help! what is the question you need help with?
Explanation:
♡♡♡♡
When does gamete production occur?
Please pleaseeee helppppp I’ll mark the brainliest!!!
Answer:
the first option is correct
Explanation:
Answer:
the lest one
Explanation: darwen belived
Body Cells are
O A) 1N
O B) 2N
O C) 4N
OD) 21N
Answer:
B) 2N
Explanation:
Body cells have 46 chromosomes and are called 2N cell. It's a diploid cell.
2N = 4 chromatids. During meiosis, the 2N cell divides into 4 nonidentical 1N cells.
The parietal pleura lines the
Answer:
Uh im confused so here is the defination The parietal pleura is the outer membrane that attaches to and lines the inner surface of the thoracic cavity, covers the upper surface of the diaphragm and is reflected over structures within the middle of the thorax. It separates the pleural cavity from the mediastinum.
Explanation:
What are the different layers that protect the brain and spinal cord? check all that apply
a. bone
b. cerebrospinal fluid
c. muscle
d. meningeal layers
Answer:
1. Bone 2. cerebrospinal fluid 4. meningeal layer
Explanation:
Which optical phenomena are formed by water droplets?
A patient with chronic venous insufficiency comes to the doctor's office complaining of leg pain. The physician prescribes two thigh-length gradient compression stockings, 45 mmHg each. HCPCS code(s):______-
Answer:
What class is this?
Explanation:
(Also if you look it up on gooogle there is an answer.) cannot answer this for you though.
The correct HCPCS Level II codes for two below the knee gradient compression stockings, 18-30 mmHg each, are A6530 x 2.
The HCPCS Level II code A6530 is used to report gradient compression stockings, below knee, 18-30 mmHg, each. The code is divided into two parts: the first part identifies the type of stocking (gradient compression), and the second part identifies the location of the stocking (below knee). The mmHg value indicates the level of compression.
In this case, the patient was prescribed two below the knee gradient compression stockings, 18-30 mmHg each. This means that the physician ordered two stockings, each of which is designed to provide a compression level of 18-30 mmHg.
The correct HCPCS Level II code for this prescription is A6530 x 2. The "x 2" indicates that two stockings are being ordered.
To learn more about chronic venous insufficiency, here
https://brainly.com/question/31838050
#SPJ2
The complete question is:
A patient with chronic venous insufficiency came to the doctor’s office with complaints of bilateral leg pain. The physician prescribed two below the knee gradient compression stockings, 18-30 mmHg each. Assign the correct HCPCS Level II codes.
3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answer: The answer is B
Explanation:
Why is it important for nerve impulses to travel rapidly?
Answer:
The messages carried by neurons are called nerve impulses. Nerve impulses can travel very quickly because they are electrical impulses. ... The sheath covers the axon, like the plastic covering on an electrical wire, and allows nerve impulses to travel faster along the axon.
Answer:
The messages carried by neurons are called nerve impulses. Nerve impulses can travel very quickly because they are electrical impulses. ... The sheath covers the axon, like the plastic covering on an electrical wire, and allows nerve impulses to travel faster along the axon.
how does asexual reproduction limit variation in species?
Answer:
less of a chance for mutations
Explanation:
Answer:
Asexual reproduction is a cheap and fast method for producing large numbers of propagules having little diversity. The method of cell division is mitosis, which produces identical daughter cells. This is largely advantageous when survival of offspring is dependent, more upon explosive population growth, than on the diversity of each individual. Plankton species are such an example, where to survive they mostly just need to out produce predation.
Most organisms engage in sexual reproduction at some point in their life cycle to introduce diversity when survival is dependent on susceptibility to parasites. Host — parasite coevolution is an arms race accelerated by diversity.
In sexual reproduction, the method of cell division is meiosis, where diversity is introduced through crossing over, independent assortment, and also, random fertilization.
Explanation:
Please help me on this question
A gear ratio is defined as which of the following?
a
output teeth of gear : input teeth of gear
b
input teeth of gear : output teeth of gear
c
speed : torque
d
torque : speed
HELP
Answer:
D
Explanation:
Two cell organelles are described below.
Organelle A: Present in plant cells but not present in animal cells
Organelle B: Much larger in size in plant cells than in animal cells
Which of the following is most likely correct?
Answer:
Organelle A is chloroplasts
Organelle B is the vacuole
Explanation:
I don’t exactly understand what it means on which one is correct, but I hope this helps you.
Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem
WILL GIVE BRAINLIEST
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
giving brainiest
Scientists find fossils of a wide variety of dinosaur species throughout Mesozoic rocks, which date from approximately 250 million to 65 million years ago. Above the Mesozoic rocks lie Cenozoic rocks, which date from approximately 65 million years ago to the present day. No dinosaur fossils exist in the overlying Cenozoic rocks.
What is the most likely explanation for the lack of dinosaur fossils in Cenozoic rocks?
A. The dinosaurs' biological diversity increased in the Cenozoic Era.
B. Dinosaurs adapted in the Cenozoic Era so that their bodies could no longer be preserved as fossils.
C. There was a mass extinction of dinosaur species at the end of the Mesozoic Era.
D. There was a mass extinction of dinosaur species at the end of the Cenozoic Era.
Answer:
C
there awasw a mass extinction of dinosaur species at the end of the Mesozoic.
Explanation:
C
Have A Great One!
Answer:
it D
Explanation:
Plants, algae in some bacteria use the energy of sunlight in the process of what
Answer: Photosynthesis
Explanation: takes in the carbon dioxide produced by all breathing organisms and reintroduces oxygen into the atmosphere. Photosynthesis is the process used by plants, algae and certain bacteria to harness energy from sunlight and turn it into chemical energy.
Answer:
photosynthesis
Explanation:
hope it helps. if you need an explanation on what that is let me know!
Which description represents a medium?
a - energy that moves with a wave
b-midway point through a wave
c- a wave that can travel through a vacuum
d- material through which waves can travel
What can you observe with the cartoon? What is your own interpretation of it?
Answer:
i think that: the volcanos are talking to eachother as if they are humans and they do not understand that the reason his neighbour "blew up" (errupted) is because they are volcanos
which type of protein is a new drug most likely to be?
a. An actin fiber
b. A myosin fiber
c. An enzyme
d. A histamine
PLEASE ANSWER.
Purple is dominant to white. A flower with the alleles PP (purple) is
crossed with a flower with alleles pp (white). What is the percent chance
that their offspring (babies) will be purple?
0%
50%
100%
Answer:
100% P is dominate there for all matches will be Pp this mean it will either be purple or a mixture of both (pink)
Explanation:
Functions of cell wall
Answer:
it protects the plant cell it give the shape to cell
AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.
Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu
The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.
Explanation:
auu,uaa,cug,uuc,ugu,cua,gag
Ile,STOP,leu,phe,cys,leu,glu
glu,ile,cys,leu,val,asp,leu (reverse)
After a STOP codon, a DNA promoter is required
Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.
1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.
In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.
2. In the given set, the possible amino acid sequences can be given as:
Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.
In the given sequence:
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.
To know more about codons, refer to the following link:
https://brainly.com/question/19153211
The image illustrates a sustainable method of providing transportation for
people in a society. How does this method compare with having many
gasoline-powered vehicles, each with only one occupant?
A. It conserves more fossil fuels.
B. It uses the same amount of fuel per person.
C. It uses more expensive fuel per person.
D. It uses more fossil fuels per person
Answer: A. It conserves more fossil fuels
Explanation:
This approach saves more fossil fuels than using lots of gasoline-powered cars, each with just one occupant. So, the correct option is A.
What are Fossil fuels?A fossil fuel is a hydrocarbon-containing substance that is recovered and used as fuel that naturally forms in the Earth's crust from the remains of dead organisms and plants. Fossil fuels include coal, oil, and natural gas. Fossil fuels can be burned to produce energy, drive engines, or provide heat for immediate use.
A general name encompassing non-renewable energy sources such crude oil, petroleum products, natural gas, derived gas, coal, coal products, and non-renewable wastes is "fossil fuel." These fuels are made from ancient geologically-dated plants and animals (for example, millions of years ago). Compared to using many single-occupant gasoline-powered cars, the method conserves more fossil fuels.
Therefore, the correct option is A.
Learn more about Fossil fuels, here:
https://brainly.com/question/3371055
#SPJ7
Select the correct answer.
The graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What’s the most likely explanation for the mixed breed’s disease incidence?
A. It has low diversity in its genes.
B. It has high diversity in its genes.
C. It’s good at saving human lives.
D. It doesn’t suffer attacks from wild predators.
E. It lives comfortably with people.
Answer:
B would be the answer
Explanation:
Select the intended meaning of the idiom in the following sentence.
The President's announcement made Washington tremble.
O The people in the government grew anxious.
O The earth shook while the President spoke.
Which method of food production is sustainable?
A. Planting only a single type of crop
B. Improving food storage facilities
c. Overusing antibiotics on livestock
D. Practicing intensive farming
Answer:
Improving food storage facilities
Instincts are more complex innate behaviors. What are some examples of instinctive behaviors in animals?
Answer:
chicks in many bird species instinctively open their mouths wide when their mother returns to the nest. the mother instinctively spits up food.
pls answer correctly
Answer:
2nd answer bubble. or the letter B
