Answer:
less of a chance for mutations
Explanation:
Answer:
Asexual reproduction is a cheap and fast method for producing large numbers of propagules having little diversity. The method of cell division is mitosis, which produces identical daughter cells. This is largely advantageous when survival of offspring is dependent, more upon explosive population growth, than on the diversity of each individual. Plankton species are such an example, where to survive they mostly just need to out produce predation.
Most organisms engage in sexual reproduction at some point in their life cycle to introduce diversity when survival is dependent on susceptibility to parasites. Host — parasite coevolution is an arms race accelerated by diversity.
In sexual reproduction, the method of cell division is meiosis, where diversity is introduced through crossing over, independent assortment, and also, random fertilization.
Explanation:
the result of successful mitotic division (three words)
3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answer: The answer is B
Explanation:
1. How can we identify a market for vegetables? Write.
2
How do you get vegetables to the market? Write the procedures in brief.
1.
Marketing is one of the most important factors in determining the success of any fruit and vegetable farming enterprise. Marketing includes all the operations and decisions made by producers. These decisions range from deter-mining the most marketable crops for production to deciding how to best deliver quality produce to the consumers at a profit. However, contrary to popular belief, marketing does not begin after a crop is produced. Instead, marketing alternatives need to be considered even before production takes place.
2.
Recent environmental and food safety concerns in the United States produce sector have brought about increasing interest in organic fruit and vegetable production as an alternative to traditional fruit and vegetable enterprises. As a result, the production and marketing of organic crops has expanded steadily during the 1980s. However, as more organic producers enter the industry and it becomes more and more competitive, existing producers are forced to become better growers and more effective marketers.
Plants, algae in some bacteria use the energy of sunlight in the process of what
Answer: Photosynthesis
Explanation: takes in the carbon dioxide produced by all breathing organisms and reintroduces oxygen into the atmosphere. Photosynthesis is the process used by plants, algae and certain bacteria to harness energy from sunlight and turn it into chemical energy.
Answer:
photosynthesis
Explanation:
hope it helps. if you need an explanation on what that is let me know!
explain the process of digestion abd absorption of carbohydrates.
Explanation:
the food u eat will goes from oesophagus to ur stomach and then it is mixed by hcl present in your stomach that makes the medium acidic for pesin to digest protein and then bile juice from liver makes the medium alkaline and breaks the larger globules of carbohydrates for enzymes then the food goes goes to small intestine that secretes intestinal juice that converts carbohydrates into glucose
AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.
Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu
The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.
Explanation:
auu,uaa,cug,uuc,ugu,cua,gag
Ile,STOP,leu,phe,cys,leu,glu
glu,ile,cys,leu,val,asp,leu (reverse)
After a STOP codon, a DNA promoter is required
Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.
1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.
In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.
2. In the given set, the possible amino acid sequences can be given as:
Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.
In the given sequence:
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.
To know more about codons, refer to the following link:
https://brainly.com/question/19153211
Select the correct answer.
The graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What’s the most likely explanation for the mixed breed’s disease incidence?
A. It has low diversity in its genes.
B. It has high diversity in its genes.
C. It’s good at saving human lives.
D. It doesn’t suffer attacks from wild predators.
E. It lives comfortably with people.
Answer:
B would be the answer
Explanation:
What are the three goals of integrated pest management (IPM)?
A) to reduce the use of insecticides, increase consumer costs, and
conserve water
B) to reduce the use of insecticides, increase farmer costs, and conserve
water
C)to reduce the use of artificial pesticides, reduce costs, and control pests
D) to reduce the use of artificial pesticides, reduce costs, and increase
salinization
Please select the best answer from the choices provided
Ο Α
B
The correct answer is C. To reduce the use of artificial pesticides, reduce costs, and control pests.
Explanation
Integrated pest management (IPM) is a method that integrates different practices and scientific principles to make adequate management with pests. This method considers knowledge about the habits, life cycle, needs, and aversions of the pest, reducing the use of toxic methods and implementing less toxic methods, monitoring pest activity and adjusting methods over time, tolerating harmless pests, setting a threshold to decide when it is time to act, among others as its main principles. Therefore, the correct answer is C. To reduce the use of artificial pesticides, reduce costs, and control pests.
Body Cells are
O A) 1N
O B) 2N
O C) 4N
OD) 21N
Answer:
B) 2N
Explanation:
Body cells have 46 chromosomes and are called 2N cell. It's a diploid cell.
2N = 4 chromatids. During meiosis, the 2N cell divides into 4 nonidentical 1N cells.
In which area of the cell does the interaction between codon and anti codon occur?
Answer:
This occurs at the 3′ end position which sits on an mRNA, while a distinct tRNA anticodon triplet sequence matches a three complementary base pair mRNA codon sequence to guide appropriate amino acid into place at a ribosome activation site to form a polypeptide or protein.
The interaction between codon and anti-codon is occurs at the 3′ end position which sits on an mRNA.
What are the functions of mRNA?Messenger ribonucleic acid is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of synthesizing a protein.
The role of mRNA is to carry protein information from the DNA in a cell's nucleus to the cell's cytoplasm (watery interior), where the protein-making machinery reads the mRNA sequence and translates each three-base codon into its corresponding amino acid.
Found in all cells, messenger ribonucleic acid, or mRNA, is a single-stranded molecule. It is responsible for transferring genetic information from DNA, found in the nucleus of the cell, to ribosomes floating in the cell's cytoplasm.
Learn more about mRNA:
https://brainly.com/question/21312423
#SPJ6
Earth makes one full rotation on its axis approximately every 24 hours. If Earth's period of rotation decreased to 20 hours, which of the following changes would occur?
There would be fewer days in a week.
The length of nighttime would increase.
It would take Earth longer to revolve around the Sun.
The length of daylight and nighttime would decrease.
Answer:
The length of daylight and nighttime would decrease.
Explanation:
If 24 hours was decreased to 20, it would shorten night and day time.
Instincts are more complex innate behaviors. What are some examples of instinctive behaviors in animals?
Answer:
chicks in many bird species instinctively open their mouths wide when their mother returns to the nest. the mother instinctively spits up food.
A patient with chronic venous insufficiency comes to the doctor's office complaining of leg pain. The physician prescribes two thigh-length gradient compression stockings, 45 mmHg each. HCPCS code(s):______-
Answer:
What class is this?
Explanation:
(Also if you look it up on gooogle there is an answer.) cannot answer this for you though.
The correct HCPCS Level II codes for two below the knee gradient compression stockings, 18-30 mmHg each, are A6530 x 2.
The HCPCS Level II code A6530 is used to report gradient compression stockings, below knee, 18-30 mmHg, each. The code is divided into two parts: the first part identifies the type of stocking (gradient compression), and the second part identifies the location of the stocking (below knee). The mmHg value indicates the level of compression.
In this case, the patient was prescribed two below the knee gradient compression stockings, 18-30 mmHg each. This means that the physician ordered two stockings, each of which is designed to provide a compression level of 18-30 mmHg.
The correct HCPCS Level II code for this prescription is A6530 x 2. The "x 2" indicates that two stockings are being ordered.
To learn more about chronic venous insufficiency, here
https://brainly.com/question/31838050
#SPJ2
The complete question is:
A patient with chronic venous insufficiency came to the doctor’s office with complaints of bilateral leg pain. The physician prescribed two below the knee gradient compression stockings, 18-30 mmHg each. Assign the correct HCPCS Level II codes.
The parietal pleura lines the
Answer:
Uh im confused so here is the defination The parietal pleura is the outer membrane that attaches to and lines the inner surface of the thoracic cavity, covers the upper surface of the diaphragm and is reflected over structures within the middle of the thorax. It separates the pleural cavity from the mediastinum.
Explanation:
What can you observe with the cartoon? What is your own interpretation of it?
Answer:
i think that: the volcanos are talking to eachother as if they are humans and they do not understand that the reason his neighbour "blew up" (errupted) is because they are volcanos
What is seed dispersal? Name some agents of seed dispersal
Answer:
The Process by which seeds spread over a wide area is known as seed dispersal..
some agents
Air
water
animals
etc..
Answer:
Seed dispersal is the movement, spread or transport of seeds away from the parent plant.
The most common methods are :
wind, water, animals, explosion and fire.
The image illustrates a sustainable method of providing transportation for
people in a society. How does this method compare with having many
gasoline-powered vehicles, each with only one occupant?
A. It conserves more fossil fuels.
B. It uses the same amount of fuel per person.
C. It uses more expensive fuel per person.
D. It uses more fossil fuels per person
Answer: A. It conserves more fossil fuels
Explanation:
This approach saves more fossil fuels than using lots of gasoline-powered cars, each with just one occupant. So, the correct option is A.
What are Fossil fuels?A fossil fuel is a hydrocarbon-containing substance that is recovered and used as fuel that naturally forms in the Earth's crust from the remains of dead organisms and plants. Fossil fuels include coal, oil, and natural gas. Fossil fuels can be burned to produce energy, drive engines, or provide heat for immediate use.
A general name encompassing non-renewable energy sources such crude oil, petroleum products, natural gas, derived gas, coal, coal products, and non-renewable wastes is "fossil fuel." These fuels are made from ancient geologically-dated plants and animals (for example, millions of years ago). Compared to using many single-occupant gasoline-powered cars, the method conserves more fossil fuels.
Therefore, the correct option is A.
Learn more about Fossil fuels, here:
https://brainly.com/question/3371055
#SPJ7
When does gamete production occur?
which type of protein is a new drug most likely to be?
a. An actin fiber
b. A myosin fiber
c. An enzyme
d. A histamine
Please help me on this question
1. Which of the following describes the amount of organic material that is available for transfer to the next trophic level after subtracting material used for respiration?
-Gross Primary productivity
-Biomass
-Net Primary productivity
0r
-Primary productivity
2. Suppose a plant is eaten by a mouse, the mouse is consumed by a snake, and the snake is in turn consumed by a hawk. What could be assumed about the level of available organic matter in the mouse versus the plant?
-There will be less organic matter available.
-There will be more organic matter available.
-Organic matter does not transfer between the plant and the mouse.
0r
-They both have the same amount of organic matter.
3. How does biomass change from lower to higher trophic levels?
-It fluctuates.
-It increases.
-It decreases.
0r
-It stays the same.
4. The incomplete burning of _____ in gasoline is known to create black carbon and contribute to global warming.
-ethanol
-methane
-carbon
0r
-carbon dioxide
5. Why are there less secondary consumers in an ecosystem than producers?
-Around 90% of energy from one trophic level to the next is available.
-There is less land to use for habitat after the producers grow.
-More tertiary consumers will eat secondary consumers over producers.
0r
-There isn’t enough energy available to support more secondary consumers.
Net primary productivity is the amount of organic material that is available for transfer to the next trophic level after subtracting material used for respiration.
When a plant is eaten by a mouse, the mouse is consumed by a snake, and the snake is in turn consumed by a hawk. In this case, there will be less organic matter available.
Biomass change from lower to higher trophic levels by decreasing.
The incomplete burning of ethanol in gasoline is known to create black carbon and contribute to global warming.
There is less secondary consumers in an ecosystem than producers because there isn’t enough energy available to support more secondary consumers.
It should be noted that global warming brings about the increase in the temperature around the world.
Read related link on:
https://brainly.com/question/8303820
pls answer correctly
Answer:
2nd answer bubble. or the letter B
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem
WILL GIVE BRAINLIEST
giving brainiest
Scientists find fossils of a wide variety of dinosaur species throughout Mesozoic rocks, which date from approximately 250 million to 65 million years ago. Above the Mesozoic rocks lie Cenozoic rocks, which date from approximately 65 million years ago to the present day. No dinosaur fossils exist in the overlying Cenozoic rocks.
What is the most likely explanation for the lack of dinosaur fossils in Cenozoic rocks?
A. The dinosaurs' biological diversity increased in the Cenozoic Era.
B. Dinosaurs adapted in the Cenozoic Era so that their bodies could no longer be preserved as fossils.
C. There was a mass extinction of dinosaur species at the end of the Mesozoic Era.
D. There was a mass extinction of dinosaur species at the end of the Cenozoic Era.
Answer:
C
there awasw a mass extinction of dinosaur species at the end of the Mesozoic.
Explanation:
C
Have A Great One!
Answer:
it D
Explanation:
What are the different layers that protect the brain and spinal cord? check all that apply
a. bone
b. cerebrospinal fluid
c. muscle
d. meningeal layers
Answer:
1. Bone 2. cerebrospinal fluid 4. meningeal layer
Explanation:
If the sodium/potassium ion pump were to stop functioning, what would eventually happen to the concentration gradients of sodium and potassium ions across the membrane
Answer:
The correct answer would be - concentration gradient will reach to equilibrium.
Explanation:
If the Na+/K= ion pump stops working which is to pump the sodium and potassium ion across the cell membrane. The movement takes place in 3:2 ratio with the help of ATP.
Eventually, the concentration gradients of sodium and potassium would be equal and found equilibrium across the membrane. This equilibrium would be reached due to passive transport that occurs in either direction across the membrane.
John had two different colored rabbits that were brothers, one grey rabbit, and one that was white with black spots. Both of these rabbits' parents were only white and black. Explain the terminology and reasoning for these color differences the brothers compared to their parents.
Answer:
They recombine in the offspring, bringing the total gene count back up to two per trait per animal. This recombination of genetic material from parents into children is why we have such diversity among both people and rabbits.
Explanation:
I majored in Biology
Functions of cell wall
Answer:
it protects the plant cell it give the shape to cell
Select the intended meaning of the idiom in the following sentence.
The President's announcement made Washington tremble.
O The people in the government grew anxious.
O The earth shook while the President spoke.
