How many chromatids make up each chromosome in G1?

it is B C and D

Hope this helps

Reflex arc, parasympathetic nervous system and somatic nervous system are the divisions of peripheral nervous system.

The peripheral nervous system is one of two components that make up the nervous system of bilateral animals, with the other part being the central nervous system. The PNS consists of nerves and ganglia, which lie outside the brain and the spinal cord.

The peripheral nervous system refers to parts of the nervous system outside the brain and spinal cord. It includes the cranial nerves, spinal nerves and their roots and branches, peripheral nerves, and neuromuscular junctions.

The peripheral nervous system is divided into two main parts: Autonomic nervous system (ANS): Controls involuntary bodily functions and regulates glands.

Learn more about peripheral nervous system:

https://brainly.com/question/23605940

#SPJ2

An organism that contains genetic material that has been isolated from another organism and inserted into it by biotechnological tools is known as a transgenic organism, and this is usually done to produce organisms that have a desired genome to, for example, have a resistance to some pathogens that could harm it otherwise, such as plagues, and this is because the inserted DNA produce a genetic output in terms that the organisms can now produce proteins that before it couldn't.

We can see this process currently used in the agricultural industry, where some plants have external genetic material in them, such as tomatoes or apples.

Answer:

Explanation:

C. transgenic organism

Transgenic refers to an organism or cell whose genome has been altered by the introduction of one or more foreign DNA sequences from another species by artificial means. Transgenic organisms are generated in the laboratory for research purposes.

The harmfully invasive Kudzu was introduced in the U.S. during the Philadelphia Centennial Exposition in 1876 where it was presented for sale as a green ornamental plant.

Kudzu is a green sturdy vine that is a climber. It is known for its sweet-smelling blooms. It is harmfully invasive because it poses great competition for the native plant, from grasses to large trees, and outcompetes them all by shading them and depleting them with their share of sunlight.

Ornamental plants are those that are grown for the purpose of decoration. These can be grown in gardens, fields or even indoors. Some examples of ornamental plants are: Snake Plant, String Of Pearls, Peace Lily, Chinese Money Plant, Air Plant and Water Bamboo.

To know more about Kudzu, here

brainly.com/question/11776380

#SPJ1

In order to answer this question, we must remember a bit of cellular metabolism, when mitochondria carry out the process of cellular respiration we can see that in the electron transport chain the final acceptor of electrons is oxygen. Therefore the correct answer for the question is option D oxygen.

Answer:

In living things, diffusion allows substances to move in and out of cells. It's how red blood cells distribute oxygen through the body. When empty blood cells enter the lungs, which have an extremely high concentration of oxygen, the molecules pass into the blood cells, filling them up.

Explanation:

Answer:

Air bubbles will create distortion in the slides causing them to give misleading information. It can also cause the organisms to move around when they shouldn't.

Answer:

B

Explanation:

since gases can pass through the phopholipids bilayer :)

If we took a linear piece of DNA and cut it with the restriction enzyme EcoRI which had three restriction sites for EcoRI, then the resulting number of fragments that it would produce is five (5) fragments in a linear sequence and four (4) fragments in a circular piece.

A restriction enzyme is a protein that has a defined catalytic activity that can be used to cut a given sequence of nucleic acids.

In this case, the EcoRI restriction enzyme can be used to cut in a specific nucleotide sequence that contains a given linear order of nucleotides in the cutting site.

Therefore, with this data, we can see that the restriction enzymes are able to cut the nucleic acids in specific sequences such as the EcoRI restriction enzyme that cut at particular nucleotide regions (this enzyme cuts at AATT positions).

Learn more about the restriction enzymes here:

https://brainly.com/question/15756650

#SPJ1

Answer: Asexual Reproduction

Explanation:

Budding and spore formation are two types of  asexual reproduction methods. Hence, gamete formation and fertilization do not occur in both types. Both cases involve a single organism or a parent. Also, the offspring is genetically identical to that of the parent in both methods.

Cells membranes are a phospholipid bilayer, with the hydrophobic "tails" of the phospholipids oriented to the interior of the bilayer, and the hydrophilic "heads" to the exterior of the bilayer.

They are fluid, which means that other molecules in them, such as proteins, are not fixed in position. One of the components of the membrane in animal cells is cholesterol, which helps to give rigidity and strength to the membrane

The cell membrane is impermeable to ions and polar molecules, while hydrophobic molecules can pass by passive diffusion.

This means that only statement 2 is true (option b).

Answer:

Germination

Explanation:

The beggining growth of the plant

Answer:

Germination

Explanation:

It's when the seed takes water from the soil. This trigger root growth to allow the seed get more water. It then develops and grows towards the sun above ground

Answer:

Kudzu was intentionally introduced to North America by the Soil Erosion Service and Civilian Conservation Corps in the 1930s for the purpose of controlling soil erosion in the American Southeast.

Energy exists in different forms, some of which are electrical, heating, chemical, luminous, among others.

Chemical energy in biological systems is based on the formation-breaking of bonds: to form a bond, energy must be expended, while when a bond is broken, energy is released.

Often, these processes require the participation of enzymes within the organisms; enzymes are proteins that decrease the activation energy of a reaction. For example, if a lot of energy is needed to break a bond, the enzyme will help to lower the energy required.

In biological systems such as humans, the energy molecule is ATP, which releases energy when a bond is broken and a phosphate group is released, leaving ADP as a product. And although it is an efficient process, the laws of thermodynamics explain that no process is 100% efficient, and therefore, some amount of energy is always released in the form of heat. Unlike chemical energy, heat energy is not stored in bonds and cannot be catalyzed by enzymes or utilized by biological systems.

Hey there! Lets begin!

1. Which of the following best describes the sum of all forces acting on an object?

______________________________________________________

2. Suppose a man is sitting on a chair and exerting 100 N of force downward, while a spring beneath the chair exerts 150 N of force upward. If you assign a negative value to the downward force, what is the net force of this system?

_______________________________________________________

3. During a game of pool, a cue ball travels to the left with 70 N of force and collides with the four ball moving with a force of 50 N to the right. If you assign a negative value to the force moving to the right, what is the net force of this system?

_______________________________________________________

4. Recall that the formula for momentum is:

                                                    P=mv

Which of the following correctly shows momentum being calculated?

_______________________________________________________

5. A hockey puck with a mass of 0.12 kg is traveling across the ice at a velocity of 150 m/s downfield. What is the momentum of the hockey puck?

_______________________________________________________

Hope this helps! Good luck!

Answer:

(Question) Which of the following best describes the sum of all forces acting on an object?

(Answer) net force, which is a vector sum

(Question) Suppose a man is sitting on a chair and exerting 100 N of force downward, while a spring beneath the chair exerts 150 N of force upward. If you assign a negative value to the downward force, what is the net force of this system?

(Answer) 50 N

(Question) During a game of pool, a cue ball travels to the left with 70 N of force and collides with the four ball moving with a force of 50 N to the right. If you assign a negative value to the force moving to the right, what is the net force of this system?

(Answer) 20 N

(Question) Recall that the formula for momentum is: P=mv Which of the following correctly shows momentum being calculated?

(Answer) 45 kg*m/s=(9 kg) (5 m/s)

(Question) A hockey puck with a mass of 0.12 kg is traveling across the ice at a velocity of 150 m/s downfield. What is the momentum of the hockey puck?

(Answer) P=18 kg*m/s

Explanation:

I just finished the quick check UwU

Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.

Mutation 1

5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'

Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.

3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'

Same sequence but from 5' - 3':

5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'

Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:

Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys

It should be noted that each chain will give rise to different amino acid sequences.

Answer:

According to the WebMD, seafood, lean beef (including tenderloin, sirloin, and eye of round) and lean pork, eggs, beans, and low-fat dairy products have the highest protein content.

The correct answer is B. sugar molecules are broken down to produce ATP. In cellular respiration sugars are broken down. During the process, they release energy that allows the cell to produce ATP.

Answer: The Pacific Plate

The Pacific Plate is the fastest, moving at more than 10 cm/y in some areas, followed by the Australian and Nazca Plates. The North American Plate is one of the slowest.

hope it helps, mark as Brainliest.

The Pacific Plate is the fastest, moving at more than 10 cm/y in some areas, followed by the Australian and Nazca Plates. The North American Plate is one of the slowest.

The Relative motion has been considered as the process that it significantly involves the motion or the speed of any object with respect to the particular point.

A mid-ocean ridge separates the Pacific plate and the Nazca plate has the off the western coast of the South America. The relative motion of these both  two plates with respect to the South America which possesses in the bidirectional manner. The Pacific plate has been moving to the west, and the Nazca plate has moving to the east.

Therefore, The Pacific Plate is the fastest, moving at more than 10 cm/y in some areas, followed by the Australian and Nazca Plates. The North American Plate is one of the slowest.

Learn more about  Pacific Plate on:

https://brainly.com/question/2566632

#SPJ2

Some natural causes of deforestation are:

- Earthquakes (cutting down trees when in the higher scales);

- Biological pests;

- Dessertification process;

- Natural climates changes (seasonality and geological change can lead to natural climate change).

The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.

This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.

An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.

Read more about Ecosystem here https://brainly.com/question/842527

#SPJ1

Answer:

probably not

Explanation:

When a velocity's magnitude and direction do not alter over time, it is said to be constant.

Constant speed refers to a speed that remains constant throughout the duration of the motion. Constant speed is demonstrated in our example of using cruise control while driving a car.

When a velocity's magnitude and direction do not alter over time, it is said to be constant. In other words, this occurs when an object's rate of change in location remains constant throughout time.

An object is considered to be moving at a constant speed when it covers the same distance in the same amount of time. When moving at a constant place, an object covers a certain distance in a fixed amount of time. S = dt is a formula that can be used to express the speed.

To learn more about Constant speed refer to:

https://brainly.com/question/13672913

#SPJ13

Frogs and humans have the same organs in its digestive system, and their functions are the same. That means that, except a few differencies, frogs and humans digestive systems are mainly the same. Both of them consists of esophagus, stomach, small intestine and large intestine, as well as the mouth. The organs work together in a similar way, digesting food since the mouth until the intestine.

Answer: An estate plan is a collection of documents and includes a will, guardianship designations, healthcare power of attorney, beneficiary designations, durable power of attorney, and a personal letter of intent, outlining your wishes, should you die or become incapacitated.

Explanation: i tryed my best

Answer:

Associates: 60

Bachelors: 120

Masters: 30-60

Doctorate: 60-120

The correct answer is B) Genetic diversity.

Genetic diversity i

The structure of venous valves in the large veins of the extremities is that the the valves in the veins are hemispherical in shape and are made up of Elastic tissue. These valves are lined by the endothelium like the rest of the veins. Beneath this endothelium, elastic tissue is present in the form layers or lamellae.

The functions of the of venous valves in the large veins of the extremities is  is to keep the blood moving in one direction which is back up towards the heart.

Veins are regarded as blood vessels located throughout your body that collect oxygen-poor blood and return it to your heart.

Veins are generally part of your circulatory system which work together with other blood vessels and the heart to keep blood moving in the body.

Learn more about veins at: https://brainly.com/question/393019

#SPJ1

Answer:

For B-

PP would have purple flowers

Pp would also have purple flowers

pp would have white flowers

For C-

Bb would not have a bobtail

bb would have a bobtail

BB would not have a bobtail present

Explanation: Trust me, bro.