3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answer: The answer is B
Explanation:
Why is it important for nerve impulses to travel rapidly?
Answer:
The messages carried by neurons are called nerve impulses. Nerve impulses can travel very quickly because they are electrical impulses. ... The sheath covers the axon, like the plastic covering on an electrical wire, and allows nerve impulses to travel faster along the axon.
Answer:
The messages carried by neurons are called nerve impulses. Nerve impulses can travel very quickly because they are electrical impulses. ... The sheath covers the axon, like the plastic covering on an electrical wire, and allows nerve impulses to travel faster along the axon.
giving brainiest
Scientists find fossils of a wide variety of dinosaur species throughout Mesozoic rocks, which date from approximately 250 million to 65 million years ago. Above the Mesozoic rocks lie Cenozoic rocks, which date from approximately 65 million years ago to the present day. No dinosaur fossils exist in the overlying Cenozoic rocks.
What is the most likely explanation for the lack of dinosaur fossils in Cenozoic rocks?
A. The dinosaurs' biological diversity increased in the Cenozoic Era.
B. Dinosaurs adapted in the Cenozoic Era so that their bodies could no longer be preserved as fossils.
C. There was a mass extinction of dinosaur species at the end of the Mesozoic Era.
D. There was a mass extinction of dinosaur species at the end of the Cenozoic Era.
Answer:
C
there awasw a mass extinction of dinosaur species at the end of the Mesozoic.
Explanation:
C
Have A Great One!
Answer:
it D
Explanation:
Help me please. Due today.
Answer:
Okay! I will help! what is the question you need help with?
Explanation:
♡♡♡♡
How many layers are in a typical landfill liner between the clay in the ground
and the solid waste?
Select one:
a. 2
b. 3
c. 4
d. 10
What are the different layers that protect the brain and spinal cord? check all that apply
a. bone
b. cerebrospinal fluid
c. muscle
d. meningeal layers
Answer:
1. Bone 2. cerebrospinal fluid 4. meningeal layer
Explanation:
Which optical phenomena are formed by water droplets?
which part of the phospholipid is located on the
outside (exterior) of the cell membrane?
Answer:
Phospholipids and Biological Membranes
Which method of food production is sustainable?
A. Planting only a single type of crop
B. Improving food storage facilities
c. Overusing antibiotics on livestock
D. Practicing intensive farming
Answer:
Improving food storage facilities
why it is important to understand this concept for the benefit of understanding other ideas in science/biology (1-2 sentences).
Answer:
the objective is to help you know more about biology as a science, how biologist and other scientist do their work, personal traits that scientist find helpful in their work, and the benefits that people derived from biology and biotechnology specially in gaining new knowledge in understanding the concepts of science/biology.
Explanation:
I don't know what concept does the question asks because it wastn't stated but I answered anyway
Body Cells are
O A) 1N
O B) 2N
O C) 4N
OD) 21N
Answer:
B) 2N
Explanation:
Body cells have 46 chromosomes and are called 2N cell. It's a diploid cell.
2N = 4 chromatids. During meiosis, the 2N cell divides into 4 nonidentical 1N cells.
A gear ratio is defined as which of the following?
a
output teeth of gear : input teeth of gear
b
input teeth of gear : output teeth of gear
c
speed : torque
d
torque : speed
HELP
Answer:
D
Explanation:
Instincts are more complex innate behaviors. What are some examples of instinctive behaviors in animals?
Answer:
chicks in many bird species instinctively open their mouths wide when their mother returns to the nest. the mother instinctively spits up food.
Bam hi cuts between what bases
When does gamete production occur?
AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.
Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu
The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.
Explanation:
auu,uaa,cug,uuc,ugu,cua,gag
Ile,STOP,leu,phe,cys,leu,glu
glu,ile,cys,leu,val,asp,leu (reverse)
After a STOP codon, a DNA promoter is required
Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.
1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.
In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.
2. In the given set, the possible amino acid sequences can be given as:
Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.
In the given sequence:
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.
To know more about codons, refer to the following link:
https://brainly.com/question/19153211
how does asexual reproduction limit variation in species?
Answer:
less of a chance for mutations
Explanation:
Answer:
Asexual reproduction is a cheap and fast method for producing large numbers of propagules having little diversity. The method of cell division is mitosis, which produces identical daughter cells. This is largely advantageous when survival of offspring is dependent, more upon explosive population growth, than on the diversity of each individual. Plankton species are such an example, where to survive they mostly just need to out produce predation.
Most organisms engage in sexual reproduction at some point in their life cycle to introduce diversity when survival is dependent on susceptibility to parasites. Host — parasite coevolution is an arms race accelerated by diversity.
In sexual reproduction, the method of cell division is meiosis, where diversity is introduced through crossing over, independent assortment, and also, random fertilization.
Explanation:
Where does precipitation occur in the water cycle?
Answer:
i think precipitation mostly occurs in the clouds
Two cell organelles are described below.
Organelle A: Present in plant cells but not present in animal cells
Organelle B: Much larger in size in plant cells than in animal cells
Which of the following is most likely correct?
Answer:
Organelle A is chloroplasts
Organelle B is the vacuole
Explanation:
I don’t exactly understand what it means on which one is correct, but I hope this helps you.
Natural selection may affect allele frequency in populations due to the fundamental forces of evolution except which of the
following?
O gene drive
O gene flow
O genetic drift
O mutation
Answer:
gene flow.
Explanation:
its right I think
Please pleaseeee helppppp I’ll mark the brainliest!!!
Answer:
the first option is correct
Explanation:
Answer:
the lest one
Explanation: darwen belived
Which description represents a medium?
a - energy that moves with a wave
b-midway point through a wave
c- a wave that can travel through a vacuum
d- material through which waves can travel
If thyroid hormones are not released, you can regulate body temperature by _____, which requires a greater use of _____.
Answer: shivering; oxygen
Explanation:
The thyroid hormones are produced by the thyroid glands and they're the triiodothyronine and the thyroxine. The thyroid hormones are required in metabolism regulation, performs digestive functions, controls the muscle of the heart, and develops the brain.
If thyroid hormones are not released, you can regulate body temperature by shivering and which requires a greater use of oxygen.
an atom that has gained or lost one or more electrons
This is called an ion. :)
which of the following statements correctly describe meiosis
PLEASE ANSWER.
Purple is dominant to white. A flower with the alleles PP (purple) is
crossed with a flower with alleles pp (white). What is the percent chance
that their offspring (babies) will be purple?
0%
50%
100%
Answer:
100% P is dominate there for all matches will be Pp this mean it will either be purple or a mixture of both (pink)
Explanation:
8. What are NAD+ and FAD? What do they become?
Answer:
What are NAD+ and FAD? ... They become NADH AND FADH2 when they pick up the hydrogens during Glycolysis (NADH only), and the Krebs Cycle.
Answer:
syteysertersgeg
Explanation:
Select the correct answer.
The graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What’s the most likely explanation for the mixed breed’s disease incidence?
A. It has low diversity in its genes.
B. It has high diversity in its genes.
C. It’s good at saving human lives.
D. It doesn’t suffer attacks from wild predators.
E. It lives comfortably with people.
Answer:
B would be the answer
Explanation:
Please help I will give a brainliest
Answer:
answer
Explanation:
im not that good w these sorry
Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem
WILL GIVE BRAINLIEST