Answer:
A- Cell Wall
B- Cytoplasm
C- Nucleus
Explanation:
please help me with this
Answer:
GGCCATAGGTCCCTTTAGCG
Explanation:
I got a 100%
When Carbon is released from living things to the atmosphere, what form does it take and what is the
chemical formula for it?
Answer:
CO2
Explanation:
carbon combines with oxthen resulting to form CO2 in atmosphere
Needing help on 9 and 10 please
a forest is cut down to plant a field of corn. how will this affect the biodiversity of the area?
Answer:
well if the forest is no longer there the life within the forest will no longer be able to survive so that eliminates a group of living things in the area causing less diversity
I need help with this question. 10+ points and Brainliest for best answer!
Relative dating and absolute dating are two different methods for finding the age of a rock. Name one advantage of each method and one disadvantage of each.
Please help! This is due in two hours.
Answer: The full explanation below.
Explanation: The advantage of Relative dating is it can tell if a rock is older or younger that a certain object where the age is also not certain making it easier to tell when the other object was from, however it dose not give an exact age of the rock. Absolute dating is different because it gives you the exact age of the rock, but does not aid in find the age of any artifacts that can be found around it. Hope this helps! :D
Absolute dating establishes the exact age of a historical relic, whereas relative dating determines the order of age of several samples. Absolute dating is therefore a quantitative measurement, whereas relative dating is a qualitative measurement.
What is dating?To date ancient events, geologists commonly use radiometric dating methods, which are based on the natural radioactive decay of certain elements such as potassium and carbon.
Relative dating is used to order geological events and the rocks they leave behind. The limitation of relative dating of fossils is that it does not provide the absolute age of the preserved fossils.
Absolute dating methods take physical properties of an object and use them to calculate its age.
Despite the fact that scientists exercise extreme caution when dating objects, recent studies show that they still make mistakes.
Because of incorrect setup, the dates used with this method are incorrect. The dates may not be consistent over long periods of time.
Thus, above mentioned are some advantages as well as disadvantages of two types of radiometric dating.
For more details regarding radiometric dating, visit:
https://brainly.com/question/14799339
#SPJ2
In which Tetrads are not formed? Meiosis or Mitosis?
Answer:
No tetrads are formed in mitosis.
Explanation: Tetrads are formed in meiosis and lead to genetic recombination. After the formation of tetrads crossing over occurs. In humans, 23 tetrads are formed in meiosis.
Which cells have the most potential for therapy and can become anything?
Answer:
Stem cells have the ability to build every tissue in the human body, hence have great potential for future therapeutic uses in tissue regeneration and repair. In order for cells to fall under the definition of “stem cells,” they must display two essential characteristics.
Explanation:
(10 points) One of the accepted scientific theories describing the origin of life on Earth is known as chemical evolution. According to this theory, which of the following events would need to occur first for life to evolve?
Answer:
Synthesis of organic molecules
Explanation:
AnsweR: C
dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd LOOK OUSIDE YOUR WINDOW dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
Please help In a neutral atom, what two subatomic particles must be equal to have the overall charge of the atom be
neutral?
Answer:
The proton and electrons must be equal.
Explanation:
A neutral atom is an atom with a 0 charge. Protons have a positive charge and electrons have a negative charge, so adding them together would be 0. For example, one proton and one electron would be -1+1=0.
Plants absorb water and nutrients from the soil into their roots. The water and nutrients are then transported to the leaves where they are used, along with energy from the Sun and carbon dioxide from the air, to make food for the plant. Which of the following parts is responsible for moving the water and nutrients from the roots to the leaves?
Answer:
Xylem cells
Explanation:
Answer: Xylem
Explanation:
In general, which trophic level has the MOST energy available to it? a Producer b Primary Consumer c Secondary Consumer d Tertiary Consumer
Answer:
A producer
Explanation:
The trophic level which has the most amount of energy is the producer. Thus, the correct option is A.
What is a trophic level?The trophic level of an organism is the position which it occupies in a food web. A food chain is a succession of organisms which eat other small and simple organisms and may, in turn, be eaten up themselves or by higher organisms. The trophic level of an organism is the number of steps which it is from the start of the chain.
The food chain follows 10% energy law, where 10% of the energy is transferred to the next trophic level, this decrease with every trophic level limits the number of trophic levels in a food chain. The maximum energy is present in producers which perform photosynthesis.
Therefore, the correct option is A.
Learn more about Trophic level here:
https://brainly.com/question/13267087
#SPJ6
True or False: Protists can be
heterotrophs (consumers) or autotrophs
(producers).
Answer:
It is true
Explanation:
pls mark brainliest
Answer:
True
Explanation:
Autotrophs are producers because they can make their own food. Heterotrophs are known as consumers because they consume producers or other consumers.
What phase is it when Each daughter cell ends up with an identical set of chromosomes and about half the organelles. I know it is Mitosis but which specific phase of Mitosis?
Which of the following are gene products?
mRNA
tRNA
tRNA synthetase
promoter
allele
nucleic acid
Answer:
I think its tRNA
Explanation:
"Explain what accounts for such a large amount of genetic variation within the human population?"
Answer:
humans are adapted to a wide range of environments, and genetic variation leads to phenotypic variation
Explanation:
It has been shown that the average genetic variation between human individuals is about 0.1% (i.e., one base pair out of every 1,0000 are different between any two individuals). This value seems low, but it is huge when we consider that the current estimate for the world population is 7,800,000,000 people. The phenotype is the result of the interaction between genotype and environment. Genetic variation is the raw material that enables some individuals to adapt to different environments. As species, humans have a high genetic diversity in order to develop a wide range of phenotypes well adapted to different environmental conditions.
Three plants were grown to study the effects of nitrate and magnesium ion deficiency on their development. They were kept in the same conditions, except for the types of minerals supplied.
Use
Plant A was provided with all essential minerals.
Plant B was given all minerals except nitrate ions. Plant C was given all minerals except magnesium ions. State three conditions, other than water and the concentration of mineral ions, that would need to be kept the same for all the plants, in order to make the investigation a fair test
Answer:
Periods of light-time Temperature Substrate/Soil typeExplanation:
Controlled variable: Variables that are controlled and have no influence on the results of the experiment. These variables do not affect the change in the dependent variable values.
These variables must be the same for all the subjects or groups (control and experimental). In the case of plants, controlled variables are probably those needed by the plants to correct development.
All plants should be exposed to the same period of light-time and the same temperature. Also, the substrate or soil where the plants are growing should be the same.
Osteoporosis is a disease that affects the bones and leads to an increase in bone fractures. Osteoporosis is most likely to be affected by which cycle?
Answer:
Hello old friend the answer is
It is likely to be affected by the Phosphorus
Explanation:
In dna different nucleotides can be created by changing the
Answer:
Different nucleotides can be created by altering the codons.
-Mutations
-Chemicals
-Insertion/Deletion
-Replication errors
-Genetics
40 POINTS PLS HELP..... PLS
18=0.125 . Which calculation is NOT a way to find 58?
Answer: the last one 1-0.125 doesn't equal 5/8, 5/8=0.0625 I believe the last one is the correct answer
Explanation:
3.How have scientists' ideas of human evolution changed over time
Please Hurry
Answer:
They once thought that humans came from monkeys and apes but now they think they come from a ancient ancestor not from the monkey or ape family.
Explanation:
A human general manner of life, including what it consumes, how it grows, and where it may dwell, might change throughout time as a result of genetic change.
What is human evolution?New genetic variations in early ancestor populations favored new capabilities for environmental adaptation, which then in turn altered the human way of life and facilitated human development.
It is generally accepted that the development of modern humans from our hominid ancestors involves four main stages in evolution, developing terrestriality, bipedalism, a huge brain (encephalization), and civilization.
They more than likely came from Africa within the last 200,000 years, an ancient form of human called Homo erectus
Therefore, Homo erectus, meaning means "upright man" in Latin, is most likely the most recent common ancestor of today's humans,
Learn more about evolution, here:
https://brainly.com/question/11975948
#SPJ2
what is smooth er resonibale for?
Afforesting is a positive effort in curbing the over use and destruction of natural forests
Answer:
Explanation:
Afforestation simply refers to a campaign in favor of tree planting, against tree cutting in reserves or vegetation and the overall protection of the Forest reserve. Afforestation in the direct opposite of deforestation which is act of cutting down and destruction of forest trees. Trees are important part of our natural environment which plays economic, biological and chemical roles in the lives of the masses. Most notably, forest trees acts as carbon sink which in turn reduces depletion of the ozone layer. Even though their are economic derivatives in the cutting selling of forest planks for various purposes, tree planting culture must be legislated in other to avoid excessive use of forest reserves.
what are the sugar-making structures in plant cells?
Answer:
Chloroplasts
Explanation:
they make sugar during photosynthesis.
A hiker finds a smooth, rounded pebble along the shore of a stream that is flowing down from a mountain.
Which of these most likely caused the pebble to have this appearance?
A,b,c or d !????
PLS I NEED HELP
Answer: B
Explanation: Transport of pebbles in a stream causes them to collide and rub against one another and the stream bed, and the resulting abrasion produces the familiar smooth and rounded shape of river rocks.
What are the products of Photosynthesis?
Answer:
There are several small products of photosynthesis but the main product is glucose . Another main product is oxygen as well.
Which choices are tenets of ecological forestry?
Choose all correct answers.
Silviculture should follow natural processes.
Foresters should consider economic priorities above ecological priorities.
Foresters should plan for the long-term and science should guide them.
Forests have intrinsic value, humans need to extract forest products, and social and economic concerns are important.
Answer:
silviculture should follow natural processes.
foresters should plan for the long-term and science should guide them.
forests have intrinsic value, humans need to extract forest products, and social and economic concerns are important.
Explanation:
took the test and notes.
DNA is known as anti-parallel. In your own words, explain what this means.
Answer:
DNA is double stranded, and the strands are antiparallel because they run in opposite directions.
Explanation:
Each DNA molecule has two strands of nucleotides. Each strand has sugar phosphate backbone, but the orientation of the sugar molecule is opposite in the two strands.
For every one bond created _ water molecule must be removed
Answer:4
Explanation:
For every bond created, four water molecules must be removed. Bonds break and join when molecules are formed.
What are chemical bonds?Different types of chemical bonds are present between different types of compounds, these bonds store energy and when the chemical reaction happens the reactance reacts they broke the bonds from the energy and create new compounds.
It takes a lot of heat to raise the temperature of liquid water, and an exceptional amount of heat to evaporate a given volume of water because hydrogen bonds need to be broken for the molecules to escape as gases.
Hydrogen bonds release water when they join or break. These bonds are formed in water and other compounds like DNA bases.
Therefore, four water molecules must be eliminated for every new link that is formed. When molecules are produced, bonds are broken and joined.
To learn more about chemical bonds, refer to the link:
https://brainly.com/question/15444131
#SPJ2
The effect of wearing tight clothes on the sperm production rate for some men.
please help
Which system transports carbon dioxide away from cells?
Answer:
The circulatory system also removes carbon dioxide and waste from cells