Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.
Mutation 1
5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'
Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.
3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'
Same sequence but from 5' - 3':
5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'
Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:
Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys
It should be noted that each chain will give rise to different amino acid sequences.
The cerebral cortex is divided into two halves called cerebral hemispheres. each cerebral hemisphere has three lobes, the parietal lobe, the frontal lobe, and the occipital lobe.
a. True
b. False
The cerebral hemisphere has four lobes, so the above statement is false.
What is Cerebral cortex?The Cerebral cortex also known as gray matter which comprises the brain’s outermost layer of nerve cell tissue and has a wrinkled appearance from its many folds and grooves. These folds have many groups called sulci and raised areas are called gyri.
These folds add to the surface area of cerebral cortex which allows large amount of information to be processed by Nerve cells. Cerebral cortex makes about half of the total brain mass. It consists of 6 layers which contains approximately 14 to 16 billion Nerve cells, thickness of about 0. 2 mm to 4 mm.
It is divided into four lobes. They are Frontal, Parietal, Temporal and Occipital which is responsible for processing different types of information.
It consist of nerve cell bodies which include end portion of Nerve cells called dendrites that's why it is also called gray matter. These dendrites receive chemical message from another cell cerebral cortex. It is gray in colour because lack of fatty covering of nerve which is called my myelin.
Thus, the cerebral hemisphere has four lobes, so the above statement is false.
Learn more about Cerebral hemisphere, here:
https://brainly.com/question/13543441
#SPJ12
Which group of scientists introduced the Three Domaine System?Aristotle and SocratesB. Fox and LinnaeusC) Woese and Fox
Solution:
The three-domain system is a biological classification introduced by Carl Woese et al (Fox). in the year 1990. In this classification, the cellular life forms are divided into the following 3 domains;
1. Archaea,
2. Bacteria and
3. Eukaryotes.
So that, we can conclude that the correct answer is:
C) WOESE AND FOX.
How did the Asian carp get to America and why are they a problem? Answer the question completely. Support your arguments with quotes from the text. Explain the how your quotes support your arguments.
Answer:
Asian carp were brought into the United States intentionally by humans to capitalize on the carps dietary preferences.
Explanation:
Smooth muscles are described as…a) Voluntaryb) Involuntaryc) Striatedd) Cardiac
Smooth muscles
This type of muscle comprises smooth muscle fibers that correspond to uninucleate cells, thin and pointed at the ends. This muscle forms the contractile portion of the walls of various organs such as the digestive tube and blood vessels, which is why it is characterized by involuntary contraction (option b).
Which has the highest potential energy - glucose or glycogen?
Glucose is referred to as the compound which has the highest potential energy.
What is Potential energy?This is referred to as the type of energy which is possessed by a body by virtue of its position and is depicted by the state of rest of a body or compound.
Glucose and glycogen are compounds which helps supply energy to the cells of the body so as to enable them perform their daily activities. Glucose however has the highest potential energy because it has more bonds and also means there is more energy available to perform different types of reactions.
Read more about Glucose here https://brainly.com/question/454703
#SPJ1
True or false? Having an autoimmune disease will eventually lead to death.Select one:TrueFalse
Answer: False
Explanation: Having an autoimmune disease will not necessarily lead to death, many of them have a treatment which allows the patient to maintain his/her quality of life.
Which state of matter does this model represent?
Compound light microscopes and transmission/transmitted light microscopes produce an image based on light transmission through the sample. Explain how the fluorescence microscope layout differs from that of transmission microscopes. Include the source of the light visualized in fluorescence microscopy in your answer.
The fluorescence microscope differs from the compound light, and transmitted light, not so much because of the structure, but instead because of how light is used to generate an image/ see the sample.
In the fluorescence microscope, the light does not go through the sample per se, instead, a filter is needed, it works with a higher wavelength, in this case, the light rays go to the sample and excite the species marked with the fluorescence substance, that is to say, the sample must be previously treated so it can absorb light and re-emitted as fluorescence (electromagnetic radiation) therefore creating an image, of light. This is possible due to the proprieties of some molecules, such as fluorochromes.
Kudzu is an autotroph, denoting that it makes its own food from…Finish the sentence ^^ with the best estimated answer
Autotrophs are organisms that make their own food, making biomolecules using simple abiotic carbon compounds, such as carbon dioxide, and energy from light (photosynthesis) or from inorganic chemical reactions (chemosynthesis).
So, we could complete the question with "abiotic carbon compounds and light energy"
the earth orbits the sun true or false
Earth rotate in an orbit around the sun. It takes 365 days, 6 hours, 9 minutes for the earth to complete its revolution around the sun. Its directional rotation to the sun is counterclockwise. Leap year is scheduled on the 6 hours, 9 minutes which is an additional 24 hour every fourth year.
Answer - True
Which type of sedimentary rock is pictured here?
Some adult chordates do not exhibit the characteristic features of the phylum Chordata. What is the likely reason?
A likely reason why some adult chordates do not exhibit all the characteristic features of the phylum Chordata, is that some features are present during development but are subsequently lost or become another structure. (option 2)
The first thing that baby ducks usually see after hatching is their mother. They then follow their mother everywhere: into the pond, around the farm, and eventually through the air. This type of behavior is calledQuestion 27 options:conditioningimprintingmimicryresponse
When a mother teaches their children something, the children themselves are learning something that will become natural later on in their lifespan. The mother teaches their offspring in order to allow their offspring to know what to do and how to survive.
When a mother is teaching her offspring, it is called imprinting. The mother is teaching, or printing in the children's mind on what to do.
All animals area. polytrophsb. heterotrophsc. autotrophsd. biotrophs
Animals
All animals are heterotrophs (option B), which means that they cannot produce their own food, and therefore they need to feed on different types of organic matter in order to obtain energy for survival.
Pavlov's experiments with dogs displays what type of behavior?A. Predator-preyB. ConditioningC C. SymbiosisD. Parental care
Pavlov's experiments with dogs displays a type of behavior of conditioning, as the dogs expected to receive food after listening to a determinated sound, being this a learnt behavior.
The correct answer is option B.
What do you think would happen to the population of peppered moths once coal use decreased and the trees no longer were covered in soot?
Answer:they would turn back white
Explanation:once the soot is gone, they return to natural colour again due to camouflage
What effects will result in an individual with this karyotype?
Answer: Trisomy 21
Expanation: tTe most common chromosomal anomaly in humans, affecting about 5,000 babies born each year and more than 350,000 people in the United States. Also known as Down syndrome, trisomy 21 is a genetic condition caused by an extra chromosome.
Tabulate in detail the comparison among Simple Diffusion, Facilitated Diffusion, and Active Transport across a cell membrane.
The cell has several types of membrane transport alternatives, being the simple diffusion, facilitated diffusion, and active transport one of the options for the cell to exchange molecules between internal and external environment.
The types of cell transport:
1 - Simple Diffusion: is a process that does not need energy (passive), used to transport small and nonpolar molecules from a region of higher concentration into a region of lower concentration (in the gradient concentration direction);
2 - Facilitated Diffusion: is a process that does not need energy (passive), used to transport larger ions and polar molecules with the help of carrier proteins or pore proteins (transport proteins);
3 - Active Transport: There is two types of active transport, primary active transport is used for molecules moving against their gradient coupled to the hydrolysis of ATP, and secondary active transport is for molecules going with more molecules against their gradient. It is a process that needs energy (active) to happen, going always against the gradient of concentration of the cell.
Of the most common cancers, which are the top 3 for 5-
year relative survival? Which are the bottom 3?
Answer:
Top 3 cancers for 5 years survival are:
1. Melanoma
2.Hodgkins lymphoma
3. Breast cancer
Bottom 3 cancers for 5 years survival are:
1. Mesothelioma
2.pancreatic cancer
3. Brain cancer
Explanation:
Prognosis describes how serious your cancer is and your chances of survival. 5-year survival means the percentage of people who will be alive 5 years after diagnosis.
What is an antibiotic?A. a chemical substance produced by microorganisms that helps the growth of other microorganismsB. a chemical substance produced by microorganisms that inhibits the growth of or kills other microorganismsC. a naturally occurring substance produced by microorganisms that helps the growth of other microorganismsD. a naturally occurring substance produced by microorganisms that inhibits the growth of or kills other microorganisms
Antibiotics are substances that inhibit the growth of other organisms, such as bacteria, but also our very own cells. These molecules are naturally produced by fungi and were discovered by Fleming in 1928. The answer option that better describes this is the last one: "D. a naturally occurring substance produced by microorganisms that inhibits the growth of or kills other microorganisms".
Antibiotics are substances that inhibit the growth of other organisms, such as bacteria, but also our very own cells. These molecules are naturally produced by fungi and were discovered by Fleming in 1928. The answer option that better describes this is the last one: "D. a naturally occurring substance produced by microorganisms that inhibits the growth of or kills other microorganisms".
Food Web AssignmentDirections illustrate the flow of energy within the aquatic system below by completing each direction below.SquidBlue WhaleSealKrillPenguinZooplankton1.) Draw in 8 arrows to show how the energy moves to create a food web. You may have to do a little research to help youmake all the correct connections!2.) Where would phytoplankton and the Sun belong in this food web? Draw it as well as an arrow connecting each one accurately.3.) How would bacteria nit into this food web? Describe how you would draw it in. 4.) Classify each of the 7 organisms in the aquatic food web, as well as bacteria, as a producer, consumer or decomposer by writing each into the correct category below. • Producer - • Consumer - • Decomposer -
For the first and second question we have:
Squid eats: Krill
Blue whale eats: Krill
Seal eats: Krill, Squid, Penguins (Only leopard seals)
Krill eats: Zooplankton (and phytoplankton)
Penguin eats: Krill, squids
Zooplankton eats: no one (in the picture, but they eat phytoplankton)
For the third question: Bacteria enter as decomposers in the food web.
Finally, for the fourth question we have:
Producers: Phytoplankton
Consumers: squids, blue whale, seal, krill, penguin and zooplankton
Decomposer: Bacteria
The F1 offspring of a cross has been provided for you. It is your job to work backwards in order to determine the genotypes, the genetic makeup, of BOTH parents that produced each cross. More specifically, what parental genotypes would give you these possible genotype combination?
To fill the Punnett Square we must place the alleles from one of the parents horizontally oriented on the top of a 3x3 diagram, and the alleles from the other parent vertically oriented on the left border of the diagram. After that, we must cross each one of the alleles from one parent with the alleles of the other, positioning the result of those crossings (Ee) in the blank space where those alleles meet. Therefore, we must look at the combinations and extract the allele that appears in the same line or in the same column, as follows:
Therefore, the parental genotypes are: EE x ee.
The process of transporting materials in a cell involves a positive change in the amount of free energy in the cell. Which of the following best describes how this process affects the cell?The process is non-spontaneous and causes an increase in entropy.The process is non-spontaneous and moves the cell away from equilibrium.The process is spontaneous and can be used to do work in the cell.The process is spontaneous and releases heat to the cell's surroundings.
The process is non-spontaneous and causes an increase in entropy.
The process is not automatic even thoug it involves transportation of materials in a cell. There is a change in the amount of free energy but there is entropy.
What is the name of the southern part of South America?
Answer:
I think Andes
Which of the following statements about the electron transport chain is true?
Group of answer choices
A) It is driven by ATP hydrolysis.
B) It includes a series of hydrolysis reactions associated with mitochondrial membranes.
C) It consists of a series of redox reactions
D) It occurs in the cytoplasm of both prokaryotic and eukaryotic cells.
Answer: I'm im 99% sure it's C "It consists of a series of redox reactions" if it's right do you mind giving a brainliest?
4 things yk about matter (in science) WILL GIVE BRANILIEST!!
elect 2 that apply.Which of these are monotremes? Select all that apply.kangaroosgiraffeduck-billed platypusdogkoala bearsspiny anteater
Answer:
Duck-billed platypus and spiny anteater
The nervous system is responsible for?
Answer:
The nervous system transmits signals between the brain and the rest of the body, including internal organs.
Explanation:
The nervous system's activity controls the ability to move, breathe, see, think, and more.
the place where a river begins is called?
The place where a river begins is called source or headwaters, being the rivers the construction from water that comes of smaller streams that join together forming tributaries.
The Meselson-Stahl experiment demonstrated that DNA replication is semiconservative. In the figure, semiconservative replication is illustrated byA) AB) BC) A mix of these methods, depending on the cell typeD) C
DNA replication is called semiconservative because, in each copy that is made of the DNA, one of the strands comes from the template. This means that all copies of DNA retain one strand of the original DNA (semiconservative). Therefore, the image that best illustrates DNA replication is A.