Leah has $300 in her checking account and her first bank credit card. She wants to purchase a couch for $250, and Christmas gifts for $200. What are her options? What should she do?

Answers

Answer 1

Answer:

see below

Explanation:

Leah can choose between the following two options.

Option 1:

Leah can withdraw $250 from her checking account and pay for the couch in cash. If she has a debit card on her checking account, she can use it to pay for the couch. The Christmas gift costs less than the couch. She can use a credit card to pay for the gift. Since credit card transactions are debts, she will incur a lower amount of debt.

Option 2:

Depending on her credit card limit, she can pay for the two items on credit. Once the credit statement is generated, she can use the money in her checking account to offset part of the credit card balance.

Answer 2

Answer:

Leah can withdraw $250 from her checking account and pay for the couch in cash. If she has a debit card on her checking account, she can use it to pay for the couch. The Christmas gift costs less than the couch. She can use a credit card to pay for the gift. Since credit card transactions are debts, she will incur a lower amount of debt.

Explanation:


Related Questions

describe the process of career planning​

Answers

Answer:

The career planning process involves taking the time to decide what your career goals are and how you'll get there. You might engage in this process on your own or with a guidance or career counselor. You can also start the career planning process at any point in your career.

Explanation:

Answer:

aalu jasto answer dinxa

Maggie is a high school senior who just received her college financial aid
award packet in the mail. While her mom watches, Maggie excitedly opens the
envelope. She sees that she has received grants, scholarships and student loans.
The thought of taking on debt makes Maggie a little nervous. Her mom tells
her that student loans are normal and that she will have more time to focus on
studying rather than having to work a part-time job in college. Is her mom’s
advice the same as the advice you’d give her? Explain what your advice would be.

Answers

Answer:

I would definitely give the same advice. The income potential for a college graduate far exceeds those of a high school graduate. I would be determined to graduate from college, good get a great job and get the loans paid off.

Explanation:

With a great education and a great job it shouldn't take long to get the loans paid off

Project: Current Event - Business Ethics
This project will focus on writing about a current event in ethics in the business world. The task is to first find an article that deals with business ethics and then write a summary of the article. In your summary, you should discuss what the ethical issue is and give your opinion of how the issue was handled. During this project, you'll accomplish the following:

Objectives

Find an article that deals with business ethics and write a summary of the article.
Current Event

Directions:

Use the Internet to find an article that deals with ethics in the business world. Once you have found and read your article on business ethics, record your summary using the following format. Upload it below.

Paragraph #1 - Summary of article including the link
Paragraph #2 - How it relates to entrepreneurship
Paragraph #3 - Your opinion of how the issue was handled
Question # 1

Long Text (essay)
Upload your three paragraphs here:

Paragraph #1 - Summary of article including the link
Paragraph #2 - How it relates to entrepreneurship
Paragraph #3 - Your opinion of how the issue was handled

Answers

Answer:

Signs of the boom are everywhere. Over 500 business-ethics courses are currently taught on American campuses; fully 90% of the nation’s business schools now provide some kind of training in the area. There are more than 25 textbooks in the field and 3 academic journals dedicated to the topic. At least 16 business-ethics research centers are now in operation, and endowed chairs in business ethics have been established at Georgetown, Virginia, Minnesota, and a number of other prominent business schools.

And yet, I suspect that the field of business ethics is largely irrelevant for most managers. It’s not that they are hostile to the idea of business ethics. Recent surveys suggest that over three-quarters of America’s major corporations are actively trying to build ethics into their organizations. Managers would welcome concrete assistance with primarily two kinds of ethical challenges: first, identifying ethical courses of action in difficult gray-area situations (the kind that Harvard Business School Lecturer Joseph L. Badaracco, Jr. has described as “not issues of right versus wrong,” but “conflicts of right versus right”); and, second, navigating those situations where the right course is clear, but real-world competitive and institutional pressures lead even well-intentioned managers astray.

The problem is that the discipline of business ethics has yet to provide much concrete help to managers in either of these areas, and even business ethicists sense it. One can’t help but notice how often articles in the field lament a lack of direction or poor fit with the real ethical problems of real managers. “Business Ethics: Where Are We Going?” asks one title. “Is There No Such Thing as Business Ethics?” wonders another. My personal favorite puts it wryly, “Business Ethics: Like Nailing Jello to a Wall.”

Explanation:

Answer:Signs of the boom are everywhere. Over 500 business-ethics courses are currently taught on American campuses; fully 90% of the nation’s business schools now provide some kind of training in the area. There are more than 25 textbooks in the field and 3 academic journals dedicated to the topic. At least 16 business-ethics research centers are now in operation, and endowed chairs in business ethics have been established at Georgetown, Virginia, Minnesota, and a number of other prominent business schools.

And yet, I suspect that the field of business ethics is largely irrelevant for most managers. It’s not that they are hostile to the idea of business ethics. Recent surveys suggest that over three-quarters of America’s major corporations are actively trying to build ethics into their organizations. Managers would welcome concrete assistance with primarily two kinds of ethical challenges: first, identifying ethical courses of action in difficult gray-area situations (the kind that Harvard Business School Lecturer Joseph L. Badaracco, Jr. has described as “not issues of right versus wrong,” but “conflicts of right versus right”); and, second, navigating those situations where the right course is clear, but real-world competitive and institutional pressures lead even well-intentioned managers astray.

The problem is that the discipline of business ethics has yet to provide much concrete help to managers in either of these areas, and even business ethicists sense it. One can’t help but notice how often articles in the field lament a lack of direction or poor fit with the real ethical problems of real managers. “Business Ethics: Where Are We Going?” asks one title. “Is There No Such Thing as Business Ethics?” wonders another. My personal favorite puts it wryly, “Business Ethics: Like Nailing Jello to a Wall.”

What is the matter with business ethics? And more important, what can be done to make it right? The texts reviewed here shed light on both questions. They point to the gulf that exists between academic business ethics and professional management and suggest that business ethicists themselves may be largely responsible for this gap.

Far too many business ethicists have occupied a rarified moral high ground, removed from the real concerns and real-world problems of the vast majority of managers. They have been too preoccupied with absolutist notions of what it means for managers to be ethical, with overly general criticisms of capitalism as an economic system, with dense and abstract theorizing, and with prescriptions that apply only remotely to managerial practice. Such trends are all the more disappointing in contrast to the success that ethicists in other professions—medicine, law, and government—have had in providing real and welcome assistance to their practitioners.

Does this mean that managers can safely dismiss the enterprise of business ethics? No. In the past year or two, a number of prominent business ethicists have been taking stock of their field from within. Much like managers trying to reengineer their companies’ business processes, they have called for fundamental changes in the way the enterprise of business ethics is conducted. And they are offering some promising new approaches of value to both academic business ethicists and professional managers.

What follows, then, is a guide to business ethics for perplexed managers: why it seems so irrelevant to their problems and how it can be made more useful in the future.

What negative effects might free trade have on small, local businesses?

Answers

Answer:

job loss, economic imbalance, deplorable working conditions, and environmental degradation

Explanation:

What is the purpose of a hazard plan?


a.Search through food for pests b.Document procedures c.identify supply chain concerns or problems d.create rules and regulations

Answers

Hazard mitigation plans are prepared and adopted by communities with the primary purpose of identifying, assessing, and reducing the long-term risk to life and property from hazard events.

Sorry if this doesn't specifically answer your question, but I hope it helps :)

Which option is an example of labor as a factor of production?
O A. A tree used to make paper
B. An artist painting a picture
O C. A government increasing taxes
O D. An industrial assembly line

Answers

Answer: B

Explanation: An artist painting a picture

An example of labor as a factor of production is  An artist painting a picture. Thus the correct option is B.

What is a factor of production?

The factors of production are referred to as elements or resources that are used in the process of production in order to strengthen the economy of the country. This factor includes land,  labor, capital, machinery, and so on.

An artist refers to an individual who has a keen interest in the artwork. He is a person who creates unique images by using creativity, innovation, colors, knowledge, and an artistic approach.

Labor as a factor of production is considered physical labor involved in producing goods and services. Here the artist is physical labor that is creating painting considered as a factor of production.

Therefore, option B is appropriate.

Learn more about factors of production, here:

https://brainly.com/question/988852

#SPJ5

The chart shows a sample paycheck stub.

A 2-column table has 6 rows. The first column has entries Salary, Federal income tax, social security tax, medicare tax, state income tax, and net pay. The second column has entries 1106.45, 122.67, 68.60, 16.04, 10.33, and 888.81.

The chart shows that federal and state taxes are

added to employee pay.
withheld from employee pay.
refunded in employee pay.
filed through employee pay.

Answers

Answer:

withheld from employee pay.

Explanation:

The term withheld means that the employer deducts the taxes from the employee's pay when processing the payroll. By withholding, the money meant for taxes will not get to the employees' accounts.

The employee's gross pay is $1,106. 45. the next pay is $888.41. the employer must have made some deductions that have reduced the net pay to $888.41. These deductions are the tax amounts that have been withheld by the employer.

1. Your older sister, Anna is trying to figure out how she's going to pay for college in the
Fall. Anna is going over her options with you one night and she narrows it down to
either putting her college education on your parents' credit card or taking out a
student loan. Which one would you suggest and why?
I
2. Anna then tells you a story about her friend, Chad. Chad has a Target credit card that
he opened a few months ago. The other day he tried to use his credit card to buy
popcom at the movies, but it was denied. Explain to your sister why this happened.

Answers

1.) student loans due to the fact that they are more secure than credit card debt and maybe have long periods before they have to be paid off.
2.) chad has a maximum amount of money he can use before it has to be paid back. Unfortunately chads maximum was so low he couldn’t even buy popcorn, or he already maxed out his card.

Calculate the profit or loss in each case below:
(a) Fixed costs: £9000 rent, £4000 insurance
Variable costs: £4500 wages, £500 delivery costs and £4000 in raw materials
Sales revenue: 1,500 units expected to sell at £25 each

(b) Fixed costs are £26,000 per year, and variable costs include wages at £10 per
unit, raw materials at £12 per unit and delivery/packaging at £3 per unit. It is expected that a business will make and sell 750 units during the year, with
a selling price of £26.

Answers

Answer:

(a) Th profit is £13,500.

(b) The loss is £25,250.

Explanation:

(a) Calculate the profit or loss

This can be calculated as follows:

Total fixed cost = Rent + insurance = £9000 + £4000 = £15,000

Total variable cost = wages + delivery costs + raw materials = £4500 + £500 + £4000 = £9,000

Total cost = Total fixed cost + Total variable cost = £15,000 + £9,000 = £24,000

Sales revenue = Units expected to sell * Price per unit = 1,500 * £25 = £37,500

Profit or loss = Sales revenue - Total cost = £37,500 - £24,000 = £13,500 profit

(b) Calculate the profit or loss

This can be calculated as follows:

Fixed cost = £26,000

Total variable cost = wages + raw materials + delivery costs  = (£10 * 750) + (£12 * 750) + (£3 * 750) = £18,750

Total cost = Total fixed cost + Total variable cost = £26,000 + £18,750 = £44,750

Sales revenue = Units expected to sell * Selling price per unit = 750 * £26 = £19,500

Profit or loss = Sales revenue - Total cost = £19,500 - £44,750 = £25,250 loss

What kind of firms manufacture and provide goods and services to consumers?

Answers

Answer:

Producers eg Bakeries, Motor assemblies and Consulting firms

Explanation:

There are three different groups in the economy. These are Customers, Producers and the Government.

Firms that manufacture and provide goods and services to consumers are called producers. Producers play a role in economics by deciding on what to produce and how to produce. This is because they use and control factors of production such as labor and machinery.

Answer:

producers

Explanation:

plato

Just take the points ;-; I'm done here
what is 2+2

Answers

Answer: 4

Explanation:

2+2=4

In addition, the addends or the summands are numbers or terms being added together

Extensive research and analysis should be done after a marketing plan is complete.
true
false

Answers

Answer:

True

Explanation:

Showing flaws on the plan would help strengthen weaker areas

False and true B) I’m happy today

QUESTION 6 of 10: Your staff consists of 7 cashiers, 3 stockers, and 5 salespeople. The cashiers are paid $12 per hour;
paid $10 per hour; the salespeople are paid $15 per hour. What is the average hourly wage across all your workers?

Answers

Answer:

$12.6 per hour

Explanation:

There are total of 15 workers, ( 7 + 3 + 5).

The total earning per hour is as below

Cashiers : 7 x $12 = $84

Stockers : 3 x $10 = $30

Salespeople : 5 x $15 = $75

Total earning per hour

= $84 +$30 +$75

=$189

Average earning = $189/15

=$12.6 per hour

Which of these individuals is an entreneur ?
A. a computer programa who starts her own software Company
B.A farmer who sells his crops in markets all over the country
C.A factory owner who relocates his operation overseas to save money
D. A governor who calls for raising taxed on wealthiest corporations ​

Answers

Answer:

A. a computer programmer who starts her own software Company

Explanation:

Entrepreneurship is the process through which new businesses are started. An entrepreneur is a person who takes risks by committing their time and resources to start a business.

The computer programmer is the entrepreneur in this case. She is starting a new software business. Other than her computer skills, she will need to be creative and innovate to develop products that will appeal to customers. She will take all risks of her new business but also stand to enjoy its success.

Economics help ASAP.
How do comparative advantage and absolute advantage impact international trade?

Answers

Answer:

70%.

Explanation:

I guess you just have to divide. I never really understood but I had this question before, lol.

Car dealer ben carte paid 97 percent of the base price of 22,567. he also paid 93 percent of options totaling 3,465. and a destination charge of $650. what is the dealers cost

Answers

Answer: im also working on my school work and i also need help i tried to work on that question im confused but i know that 22,567-97% is 677.01

Size is limited under a Sole Proprietorship.
True
False

Answers

Answer:

True

Explanation:

because 1 person can't control a huge company or business

Pam and Ralph work at a factory with a labor union. Pam and Ralph may have to


trust another person to negotiate their wages

attend training during unpaid overtime

reduce working hours to increase productivity

have their wages garnished to avoid unemployment

Answers

Answer: have their wages garnished to avoid unemployment

Explanation:

Pam and Ralph must garnished their wages too avoid unemployment in future.  This is because they have to decide the actual pay per day or monthly to avoid any kind of discrimination with their employers. They must also negotiate with their employers for payment to avoid unemployment due to high pay. They should not trust others for the negotiation with others. They can attend training for a work but it should be paid according to the labor standards and it should not include overtime.

Answer:

a) trust another person to negotiate their wages

Explanation:

While writing a formula, what are some ways to insert a cell reference into the formula? Check all that apply
hovering the mouse pointer over the cell to reference
typing the cell name, such as "B4
clicking the cell to reference
Zooming in on the cell to reference

Edge answer

Answers

Answer: B and C are correct

Explanation:

Just did the assignment

Answer:

B. typing the cell name, such as “B4”

C. clicking the cell to reference

Explanation:

gang gang edge 2020

reflection of food and beverage

Answers

Answer:

The interpretation of the sort of situation is characterized following portion.

Explanation:

Food and beverage organizational leadership would be important for generosity, tourist activities, and instructional design learners. Relatively increased educators are encouraged throughout the resource allocation of different approaches. Because several learners have the understanding and although F&B capitalists, evaluation using these thoughts and feelings can be an essential part of the strategy.

please answer I would like to not fail this test so can someone hook me up with the answer it between b and c for me but im include all the options in case i'm completely wrong.


_____ makes a good impression in a job interview.


Bringing a friend with you

Arriving early and alone

Bringing your textbooks

Listening to music

Answers

Answer:

Arriving early and alone

Explanation:

well first is that if you were to bring a friend with you on a job interview they could cause a distraction and that would nake you not get the job because most people or in this case your boss would not be able to trust the fact that you pay attention to what you have to do for your job and same would go if your listening to music that would be a distraction because you have to listen to what the persons is asking you to do and bringing no need you should of already study the questions and aswers.so therefore that only leaves you with arriving early and alone.

Answer:

B

Explanation:

Bringing your textbooks; not correct because they'll think you arent confident enough and remember confidence is the key.

Bringing a friend with you; What type of person brings their friend to a interview? This is obviosly not the answer.

So in conclusion, the answere would be Arriving early

Dont give some bolonie long answer just say a, b, c , or d and If you don’t now or you think you now don’t answer thanks


Which HTML tag is formatted correctly?

This is a heading
This is a heading
This is a title
This is a paragraph

Answers

Answer:

your answer is

B. This is a heading

good luck :)

Explain why flexible price policy is not price discrimination.

Answers

Answer:

see below

Explanation:

Flexible pricing is a strategy that leaves room for negotiation between the seller and buyer. In this strategy, the seller does not set a fixed price. They set a range in mind, allowing for negotiations with the buyer. In flexible pricing, a seller will have the minimum amount they can accept and a maximum amount they can charge.

Price discrimination is a pricing strategy where a producer sets different prices for the same product to different groups of consumers.  The producer will segment or group customers depending on various traits such as social status or income levels.  A price will be set for each category depending on the producer's perception of their ability to pay.

In price discrimination, the price is already set for different categories of customers, but in flexible pricing, every customer has the opportunity to negotiate for the best price.

When a company asks that people sign a contract to show they do intend to purchase the product, the situation involves.
A.) Marketing Mix
B.) Sales
C.) Target Market
D.) Customer Wants
E.) Customer Needs
F.) Marketing

Answers

Answer:

Target Market

This is the right answer

A company asks that people sign a contract to show they do intend to purchase the product, the situation involves. the Target Market.

What is the market?

The entire number of buyers and sellers in the area or region under consideration is referred to as the market. Earth, as well as several nations, regions, states, and cities, may be the subject. The worth, expense, and cost of the goods traded depend on the forces of supply and demand in the market.

The term target market refers to that. A serviceable obtained market, By which the group of customers,  a business aims its marketing efforts and resources. A target market is a subset of the total market for a product or service.

Therefore, Thus option (C) is correct.

Learn more about the market here:

https://brainly.com/question/13414268

#SPJ2

how is a job search conducted​

Answers

you provide what you like like and santa brings it to north pole and see what is best for you

When your company pays for a promotional message, that is a form of what?
A. Advertising
B. Public relations
C. Word of mouth
D. Market research

Answers

Answer: advertising

Explanation:

Answer:

A

Explanation:

got it right on Edge

write the key points about a teacher's role
can someone pls help me??​

Answers

classroom instruction to help students learn. Planning, preparing, and delivering lessons, giving feedback, helping students want to learn, and supporting.

A record store that sells $1,000 woth of CDs per day to 40 customers ( the average cost of goods sold per unit is $12.50) How much is the store COGS? ____________________

Answers

Answer:

$500

Explanation:

COGS or the cost of goods sold is the total cost of all goods sold in a period. It is the direct cost of productions and include direct labor costs, direct materials, and direct overhead costs.

In this case, The average cost of goods sold per unit is $12.50. The business sells to 40 customers. The totals cost of goods sold or the COGS will be

=$12.50 x 40

=$500

Luis got himself in trouble by accidentally sending an e-mail to a client instead of his co-worker. He resolved to be more careful in the future to prevent this from happening again. Luis can use these practices to help him avoid sending out e-mail to the wrong person.

Answers

Luis can use these practices to help him avoid sending out e-mail to the wrong person: Be careful when using the reply to All feature and to Double-check the Cc and Bcc fields.

What is email?

Email can be defined as a communication channel that enables a person to exchange information with another person.

Based on the information given in order to prevent repeating the same error or mistake, the best thing is to always re-check the  Cc and Bcc before sending out the email.

Inconclusion Luis should be careful when using the reply to All feature and to Double-check the Cc and Bcc fields.

Learn more about email here:https://brainly.com/question/1538272

For each obstacle, select the best solution.

not getting in to a class:

failing a class:

not being accepted to college:

not saving enough money to pay for college:

Answers

Answer:

3 3 1 2

Explanation:

Answer:

3 3 1 2

Explanation:

Other Questions
Sales TaxSelling Price Rate of Sales Tax Sales Tax$50.004%?The sales tax is $ GIRLS do u prefer putting ur hair back behind your ears or leave it down during school In which situation would you most likely use formal language?Group of answer choicesplaying an online game with your friendsNo answer text provided.asking your principal a questionemailing your friend How are food webs and food chains related? HELP IF YOU WANT BRAINLEIST!!Food webs only contain consumers.Food webs consist of only one food chain.Food webs are made of many food chains.Food webs only contain producers. A new bridge has a weight limit of 3 tons, tiene car weighs 7,900 lbs. Will the besble to drive hercare across the bridge, explain why or why not what's the perimeter of a triangle with sides 2 inches, 3 inches, and 4 inches in length? what tress does hemlock woolly adelgid affect? When Georgions on the home front read about the Pacific Theater during World War II, they were reading about thegoal of defeatingGermanyJapanChinaItaly Which of the following are adjacent angles? I need help!!!!!!!!!!!!!!!!!!!!!!!!!!!! :) Three (3) movie tickets cost $36. At this rate, what is the cost perticket?O $18$33O $12O $108 Select the correct answer.Susan is planning to create a vector mask for an image. What editing tools can Susan use to create a vector mask? .a Pen tool or a Shape toolOB.a Painting tool or a Select toolOC.a Dodge tool or a Burn toolOD.a Type tool or a Type Mask tool What would be the final step to applying your customized voting butons in Outlook messages?O Type your new choices in the Text Bar.O Click on Voting Buttons and choose Custom.O Open the Voting Buttons menu and choose your customized choices.O Click Submit and your custom voting choices will appear in the message body. 320 grams of brass released 5000 J of heat. If it has an initial temperature of 50C, what is its temperature after releasing the heat? The specific heat capacity of brass is 376 J/kg. * Harvesting wood from forests is one the top industries in the world. There are various ways for loggers to harvest this wood. Which of the following would provide the best sustainable use of the land?A. Strip cutting the trees because only mature trees are cutB. Clear cutting the trees because it is the most cost effective methodC. Clear cutting the trees because it produces the greatest timber yieldD. Strip cutting the trees because it minimizes widespread destruction decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA Read the conclusion from the Declaration of Sentiments. Then, answer the question.1What is Elizabeth Cady Stanton demanding?2She wants women to become US citizens.3She wants women to have special privileges.She wants women to have all the rights they are due as US citizens.In view of the unjust laws above mentioned . . . we insist that [women] have immediate admission to all the rights and privileges which belong to them as citizens of the United States.- Declaration of Sentiments1848 According to sea wolf which quotation from the excerpt most clearly helps to build tension by portraying an external conflict Please help me plot this True or False: The moon does not have anatmosphere, plants, animals or oceans.