Of all of the energy given off by the Sun directed towards Earth, approximately only 50 percent of the energy penetrates directly to
the surface of Earth. What is the best explanation for what happens to the rest of the energy?

A) Energy is lost during while traveling through space.

B) Energy is reflected or absorbed by Earth's atmosphere.

C) Some of the energy is reflected back into space by the Moon.

D) Energy is lost through the process of overcoming the Sun's large gravitational force.

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

Answer:A

Explanation:

Answer:

The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.

Explanation:

It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.

Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.

One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.

Answer/Explanation:

During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.

But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.

Answer:

I believe that the answer is A. Natural processes only, although I could be wrong.

Explanation:

There are two types of weather, mehanical and chemical, but I think the answer is A.

The correct order of events of DNA replication is as follows:

DNA REPLICATION:

Learn more at: https://brainly.com/question/16464230?referrer=searchResults

Answer:

Harmful Algal Blooms (HABs) are produced by naturally occurring cyanobacteria in lakes and ponds, including the Prospect Park Lake and other bodies of water in the NYC area.

Explanation:

there is non

Answer:

the first one

Explanation:

the car slowly started and accelerated

Its the second one. Since its continually accelerating.

Answer:

stem cells

Explanation:

Answer:

A-4. the cell wall

D-5. the cell walls function is similar to, or like a

B-2. plant cell have a

E-3. the cell membrane

C-1. all cell have a

Answer:

Also called facilitated transport or passive-mediated transport, facilitated diffusion occurs when molecules or ions are processed through spontaneous passive transport. The ions and molecules are moved across a biological membrane through certain transmembrane integral proteins.

Explanation:

There ya go!! Brainliest plss!! :))))

While many homeowners shovel snow themselves, some sign an annual snow removal contract. Highly rated snow removal contractors say customers who sign a contract. annual snow removal contracts in 2013 reported paying an average of $378, million 4 years ago.

State tax revenues in December and January fell far short. projected increases in outstanding debt and annual debt service. year and SFY 2019-20 by a total of nearly $2 billion. The initial Executive Budget proposed using $500 million of the U.S. economy, as of the end of 2018, was in.

For nearly 20 years, the American Society of Civil Engineers has been on average, there were 188 million trips across a structurally deficient. ASCE analysis of U.S. Department of Transportation, Federal Highway assistance and may finance over $2 billion in water infrastructure investment.

These are all from different things, hope one of them helped!! (but if they didnt, super sorry!)

The annual cost of snow removal for streets and highways is estimated to be $2 billion.

A report from the environmental department in one of the universities in the United States gave an estimation of 2.3 million dollars as what is spent yearly to get snow and ice off the streets and highway.

Snow removal is simply an action that is undertaken to get snow off the streets or road after it snowed for safe and easy movement of people.

In conclusion it is estimated to be about $2 billion dollars given 2.3 billion dollars is around this figure.

https://brainly.com/question/810446?referrer=searchResults

Answer:

a wild fire of a spreading fire that reaches a global span

Explanation:

Answer:

Key concepts and summary. A supernova occurs on average once every 25 to 100 years in the Milky Way Galaxy.

Explanation:

please give me a heart

Answer:

9) 75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.

10)Since, 102.2°F is greater than 100°F, Stephen can't go to school today.

Explanation:

9) First, we want to find out 24°C converted to Fahrenheit

           What we want to find                   Equation

                   24°C = ?°F                         F= (C * 9/5) + 32

Second, we have to input our number into our equation

                                    F = (24 × 9/5) +32

Next, we have to use the PEMDAS strategy (ask in the comments if you don't understand!)

       24 × 9/5 =

      24 × 9 = 216                           216÷5 = 43.2

      1   ×   5 = 5

Now, we can't forget to add 32!

43.2 + 32 = 75.2°F

24°C = 75.2°F

75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.

10) For this problem, I'm going to just show the math, so if you have any questions feel free to ask in the comments!

Step 1) 312 = C + 273

           -273        -273

Step 2) 39 = C or C = 39

Step 3) F = (39 × 9/5) + 32

Step 4) F = (351/5) + 32

Step 5) F = 70.2 + 32

Step 6) F = 102.2

Since, 102.2°F is greater than 100°F, Stephen can't go to school today.(and should think about getting a regular thermometer ;)

Hope this Helps! :)

Have any questions? Ask below in the comments and I will try my best to answer.

-SGO

50% water and 50% vinager

Answer: it has long days

Explanation:

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Answer:

I think answer choice D

Explanation:

The passage summarized says that ostriches and rheas look exactly the same but are different sizes, therefore answer choice D is auto eliminated

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

Answer:

Explanation:

energy is used, everything uses energy especially living organisms

Answer:

Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.

Explanation:

Answer:

That probably refers to asteroids.

Explanation:

There is a large belt of asteroids between the orbits of Mars and Jupiter.

Answer:

Carbon dioxide is a colorless gas with a density about 53% higher than that of dry air. Carbon dioxide molecules consist of a carbon atom covalently double bonded to two oxygen atoms. It occurs naturally in Earth's atmosphere as a trace gas.

Answer:

The air that you breathe out. Also it is what plants breathe in.

Explanation:

Hope this helps!!

Answer:

A human

Explanation:

Answer:

A

Explanation:

Since the law of conservation of mass is valid under all circumstances, hence, mass always remains the same, whether a substance undergoes physical change or chemical change

Answer:

01). cells

02).seeing inside the cells

03).Robert hook

Answer:  A

coz its just sliding one another

Hope it is correct

^_^