please help me with this

Please Help Me With This

Answers

Answer 1

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%


Related Questions

What is the population density of a city with a population of 268,931 in 6,995 square miles?

Answers

652,190

Explanation:

All you gotta do is add

Which label best describes this image?

Explosive eruption—beware of ash!
Gases push out magma with great force!
Volcano quietly erupts due to low-viscosity magma!
High silica content of magma results in lava reaching sea level by morning!

Answers

The label that best describes the image is Volcano quietly erupts due to low-viscosity magma!. The correct option is c.

What are volcanoes?

A volcano is an aperture or vent through which lava, tephra (small rocks), and steam are released onto the surface of the planet.

The broad-domed volcano with gently sloping sides known as the Shield Volcano is known for its frequent eruptions of fluid, basaltic lava.

A broad-topped volcano with gently sloping sides known as the Cinder Volcano is known for its frequent eruptions of fluid basaltic lava. A broad-topped volcano with gently sloping sides known as a composite volcano is one that frequently erupts with fluid basaltic lava.

Therefore, the correct option is c. Volcano quietly erupts due to low-viscosity magma!

To learn more about volcanoes, refer to the link:

https://brainly.com/question/2681336

#SPJ6

The question is incomplete. The image is added below:

Answer: C on edg : Volcano quietly erupts due to low-viscosity magma!

Dichotomous Key! Please help

Answers

Answer:

the presence of antennae

Explanation:

You are a prokaryotic cell that all of a sudden as the ability to take on 3 organelles or cell structures that you don't have, which 3 would you pick and why?

Answers

Answer:

Nucleus, mitochondrion, and chloroplast

Explanation:

If I were to be a prokaryotic cell that suddenly develops the ability to take on 3 organelles that I do not already have, I would pick a nucleus, a mitochondrion, and a chloroplast.

The presence of the nucleus would enable the freely lying genetic materials in the cytoplasm to become organized and packaged within the nucleus, thereby enabling more controls over transcription and translation processes.

Also, the presence of mitochondrion would increase the efficiency of energy generation through oxidative phosphorylation and the chloroplast will enable the cell to be able to manufacture its own food through photosynthesis rather than depending on external sources for foods.

What does the Big Bang Theory explain? -How the universe was created.
-The brightness of stars.
-How many stars there are in the Milky Way.
-The way that black holes are formed.​

Answers

How the universe was created:)

Calculate the increase
in the mouse population
between months 23 and 25.
Show your work.

Answers

I’m not 100% sure if this is right but the mouse population is around 1.0 million and for 25 months it’s around 3.4 million, once again I’m not 100% sure if this is right

The mouse population has increased exponentially from 23 months to 25 months. There is an increase from 0.9 to 3.4. Hence, a nearly 2.5 million rise is seen.

What is population growth?

A population is a group of similar individuals present in a particular environment. The tiger population, for example. A population growth depends upon the carrying capacity of the environment. Carrying capacity is defined as the potential of an environment to hold a population. It varies for different populations.

If the carrying capacity is lower for a population, they have a lower chance of survival in that environment. In that environment, they get less food and less space to live. They can't grow exponentially.

When a population's carrying capacity is high, it receives more food and more living space. They grow exponentially in that environment. In the mouse population, between these two months, they grow exponentially due to the proper availability of resources.

Hence, 2.5 million growth is seen in mice between these two months.

To learn more about population growth, refer the link,

https://brainly.com/question/18415071

# SPJ2

Iron is attracted to a magnet while tin is not. If a mixture of iron and tin pieces is placed near a magnet,​

Answers

Answer:

The iron will separate from the tin.

Explanation:

Does it matter whether DNA sequence the mutation occurs

Answers

Yes, because if the sequence changes then it is not DNA anymore

Both a solar eclipse and a lunar eclipse involve the alignment between the Sun,
Earth, and the Moon, but in different positions. What is the difference between a
solar eclipse and a lunar eclipse?

A: The position of the Moon and Earth are different.

B: The position of the Sun and Earth are different.

C: The position of the Sun alone is different

D: The position of Earth alone is different

Answers

Answer:

The position of the Moon and Earth are different.

What is the student doing

Answers

answer is drawing conclusions

Answer:

Explanation:

making a prediction

There are many factors that may cause a mutation in a gene. Which of the following events would be most likely to cause a mutation?
mRNA travels out of the nucleus.
mRNA is released from the DNA strand.
A nucleotide is inserted into a DNA strand
An enzyme transcribes mRNA in the nucleus

Answers

Answer:

Since there are many factors that can produce a mutation, the event that would be most likely to cause a mutation is a nucleotide is inserted into a DNA strand.

Explanation:

A genetic mutation involves an alteration of the DNA that leads to a defect in protein synthesis and a structural or functional alteration of an individual.

Of all the factors that can produce a mutation, the insertion of one or two nucleotides into the DNA strand produces a point mutation, or molecular mutation, of the insertion type.

    The other options are not correct because the processes of mRNA traveling out of the nucleus, mRNA releasing from the DNA strand or enzymatic transcription of mRNA in the nucleus can carry over a mutation produced in the DNA, but they are not mutation-producing factors.

explain eutrophication and why it isn't good for an ecosystem

Answers

Eutrophication is when the environment becomes enriched with nutrients. This can be a problem in marine habitats such as lakes as it can cause algal blooms. Some algae even produce toxins that are harmful to higher forms of life. This can cause problems along the food chain and affect any animal that feeds on them.

Hope it helps ^^

Answer:

Excessive nutrients lead to algal blooms and low-oxygen (hypoxic) waters that can kill fish and seagrass and reduce essential fish habitats. Eutrophication sets off a chain reaction in the ecosystem, starting with an overabundance of algae and plants.

Explanation:

brainliest plzz

How Do You "Win" At Natural Selection?

Answers

Answer:

choose the best option?

Explanation:

"Winning" at natural selection refers to successfully passing on one's genes to the next generation.

What is natural selection?

Natural selection is a mechanism of evolution that favors traits that increase an organism's chances of surviving and reproducing. In order to "win" at natural selection, an organism must have traits that help it survive and reproduce in its particular environment.

For example, a bird with a beak that is well-suited to its particular food source is more likely to survive and pass on its genes than a bird with a less suitable beak. However, it's important to note that natural selection is not a conscious or deliberate process, and there is no "goal" or "endgame" to evolution. Instead, it is simply a description of the mechanism by which species change over time.

Learn more about natural selection, here:

https://brainly.com/question/2725702

#SPJ6

How does the sperm come in contact with frog eggs?
1. The sperm is placed on top of the eggs
2. The sperm is carried through a reproductive system
3. The sperm is carried to eggs via water

Answers

2. The sperm is carried through a reproductive system.

What phase of the cell cycle does DNA replicate?A. Prophase
B. Anaphase
C. Metaphase
D. Interphase

Answers

Answer:

Option - D

Hope it helps you

Mendel worked with pea plants, which are usually Choose... ( cross-pollinating or self-polllinating) .When he transferred pollen from one pea plant to another, he was Choose...(self-pollinating or cross-pollinating) the pea plants to Choose...(self-pollinating or cross-pollinating) the eggs and form embryos within a seed.​

Answers

Answer:

1.) Self-Pollinating, 2.) Cross-Pollinating, 3.) Fertilize

Explanation:

Pea plants are know to self-pollinate, so when Mendel transferred pollen to one pea plant to the other, it would be called cross-pollinating. Think of it as exchanging. This allowed the pea plants to fertilize the eggs.

1.) Self-Pollinating,

2.) Cross-Pollinating,

3.) Fertilize

Mendel's seminal work was accomplished using the garden pea, Pisum sativum, to study inheritance.This species naturally self-fertilizes, meaning that pollen encounters ova within the same flower. The flower petals remain sealed tightly until pollination is completed to prevent the pollination of other plants.   Pea plants are know to self-pollinate, so when Mendel transferred pollen to one pea plant to the other, it would be called cross-pollinating. Think of it as exchanging. This allowed the pea plants to fertilize the eggs.

Learn more:

brainly.com/question/1483517

How does carbon dioxide affect the Earth's climate?
Carbon dioxide is being added to the soil, which causes weather phenomenon.
While carbon dioxide is in the air waiting to be reabsorbed it traps the sun's
heat.
Carbon dioxide mixes with water vapor to take harmful chemicals out of the air.

Answers

The answer seems like it might be “while carbon dioxide is in the air waiting to be reabsorbed, it traps the suns heat.”

Carbon dioxide affects the Earth's climate while carbon dioxide is in the air waiting to be reabsorbed; it traps the sun's heat. The correct option is b.

What is carbon dioxide?

Carbon dioxide whose chemical formula is CO2 is a chemical compound made up of molecules that each have one carbon atom covalently double bonded to two oxygen atoms. It is found in the gas state at room temperature.

In the air, carbon dioxide is transparent to visible light but absorbs infrared radiation, acting as a greenhouse gas. It is a trace gas in Earth's atmosphere at 421 parts per million, or about 0.04% by volume as of May 2022, having risen from pre-industrial levels of 280 ppm. Burning fossil fuels is the primary cause of these increased CO2 concentrations and also the primary cause of climate change. Carbon dioxide is soluble in water and is found in groundwater, lakes, ice caps, and seawater.

When carbon dioxide dissolves in water, it forms carbonic acid, which causes ocean acidification as atmospheric CO2 levels increase.

Learn more about carbon, here:

https://brainly.com/question/22530423

#SPJ6

A hand lens or magnifying glass is strong enough to view cell organelles.

True
False

Answers

False you need a microscope for that

A serve flood brings a lot of sediment and silt into the black river. The oxygen of the river decreases greatly. What is the r limiting factor?

Answers

Answer:

oxygen

Explanation:

A limiting factor is any condition whose decrease, increase, absence or presence is able to limit/stop population growth. Examples of limiting factors include abiotic conditions (e.g., temperature, water, oxygen, CO2, etc) or biotic conditions (e.g., food, mate, etc). There are many aquatic species that require high levels of oxygen (e.g., fish), thus being it a limiting factor for these species.


A major source of variation is mutations.
True
False

Answers

A major source of variation is mutations are true
True? I’m not sure tho

When completing a soil texture test silt particles feel? Sticky, gritty, or smooth?

Answers

Answer:

Soil texture is determined by the size and proportion of the particles that make up the soil. Every soil can be separated into three fractions – sand, silt, and clay. Sand particles are the largest and make the soil feel gritty. Silt particles are medium sized and give a smooth, floury feeling to the soil.

Uh, I hope it helps you understand? :T

PLEASE HELP DUE IN 10 MINUTES!!!!
There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).
Which type or types of RNA contain a copy of the instructions that a gene carries?
A. mRNA only
B. rRNA only
C. mRNA and tRNA
D. mRNA, rRNA, and tRNA

Answers

Answer:

A.  mRNA only

Explanation:

The type of RNA that contains a copy of the instructions that a gene carries is mRNA.

RNA stands for ribonucliec acid. It is genetic material in some organisms like viruses. It is of three types, namely mRNA, rRNA and tRNA. mRNA contain a copy of the instructions that a gene carries.

What is translation?

Translation is the process of formation of protein by mRNA.  

In this process the gene encodes a protein, and instructions are given for making protein.

mRNA plays main role in protein synthesis, as it contain a copy of the instructions that a gene carries.

Thus, the correct option is A.

For more details regarding translation, visit:

https://brainly.com/question/16305501

#SPJ2

Plz help nobody is helping me plzzzzzzz

Answers

Answer:

24800

Explanation:

To get the velocity for this problem

we need to simply multiply the number together

124 × 200 = 24,800

Velocity equation

Hertz x meters = velocity

Which of the following explains why food is cheaper and more available now than at any time in history?
More people in developing countries are eating more grains than meat.
Farmers can produce more crops from the same amount of land.
More farmers are purchasing neighboring lands to add to their holdings.
Scientists have developed “super seeds” that are rich in energy.

Answers

Answer:

because taxes and prices in the stockmarket are going up so they have enough money so they lower the prices

Explanation:

Answer:

B: Farmers can produce more crops from the same amount of land.

Explanation:

American farms grew larger and more productive at the same time that the global demand for their crops, and the food made from those crops, accelerated. The United States exported 6,988,000 metric tons of corn in 1960. In 2007, the United States exported almost nine times that amount: 61,913,000 metric tons of corn. Corn exports have declined since 2007 because the growth of the ethanol industry has kept more of the corn crop at home. To meet the growing global demand for corn on basically the same amount of land, American farmers improved the productivity of their crops: corn yields, as measured in tons per hectare, more than doubled from 1960 to today.

Hope this helps :)

calculate the heat energy lost by the zooplankton

Answers

Answer:

2273 Is the amount of heat energy lost by zooplankton

Explanation:

8. In the beaker, the water nearest the flame becomes

Answers

Answer:

did you get the answer yet

What are two resources for which organism would compete?

Answers

Answer:

Air, food, water and space

Answer:

Organisms compete for the resources they need to survive- air, water, food, and space. In areas where these are sufficient, organisms live in comfortable co-existence, and in areas where resources are abundant, the ecosystem boasts high species richness...


Each cell needs a full instruction manual to operate properly. DNA needs to be copied before cell division so that each new cell receives a full set of instructions.However, DNA cannot begin the process by itself. Describe how the uptake of glucose can make this process take place.

Answers

Answer:

sorry but i need these points for a assignment

true or false the mitochondriion organelle is considered the " mighty power house " because it makes ATP .

Answers

It is true.
ATP is the cells main energy carrying molecule, which the mitochondria makes

Match the organisms to the description.


there’s a scorpion, starfish, octopus and a bird

the descriptions are “lacks colored blood”
“has a soft unsegmented body”
“is a vertebrate”
“lacks antennae”

Answers

Answer:

starfish has unsegmented body

bird is a vertebrate

octopus packs colored blood

scorpion lacks annternna

Other Questions
What event resulted in Harry Truman becoming president in 1945? what do you mean by court of record Xavier has x dollars. Nicole has 28 more dollars than Xavier. Which expression represents the amount of money that Nicole has? get this right and ill matk you brainliest whoever gets this right gets brainliest Rachel has successfully avoided all temptations to drink alcohol throughout high school. What would be Rachel's best option for continuing the healthy lifestyle? I need help please please please Lillian is interested in understanding how borderline personality disorder affects everyday behavior in a clinical population.She most likely will use the methods and the models of the _____ domain of knowledge about human nature in conducting her research.A) dispositionalB) biologicalC) adjustmentD) intrapsychic Where are the majority of Jewish people located in Southwest Asia today? ways the civil war affected the development of the Louisiana economy? please help me Study the quote to answer the question:"The tracking of online activity is not just a privacy issue," claims activist Hughes, "But an economic and political minefield."What is wrong with the format of this quote? It is missing one set of quotation marks. The word "But" should not be capitalized. It is missing an internal citation for the source of the quote. The comma after "issue" should appear after the quotation mark. Percy says he's not normal. What does he mean? Why does he say it? how do you solve this question and explanation -8=c/-10 please solve the following: 1. 5x=22. At a restaurant, Mike and his three friends decided to divide the bill evenly. If each person paid $13 then what was the total bill?A. $13B. $52C. $39 Please help me ASAP!!! Will give Brainliest!! Fairly easy geometry problem!! come on plz tell me someone is awake PLEASE HELP ASAPConstruct a function with a rate of change of 2/3 and an initial value of 4.(Put your equation in slope-intercept form or y = mx + b) NEED ANSWER ASAP!!!!!!!!!!!!!!!!!!! Identify each of the following as an element, a compound, a homogeneous mixture, or a heterogeneous mixture: jenna is making pancakes, but she want to do it half. for full recipe she needs 1 1/2 cups of flour. how much does flour does she need for a half of the recipe?