Answer:
GGCCATAGGTCCCTTTAGCG
Explanation:
I got a 100%
What is the population density of a city with a population of 268,931 in 6,995 square miles?
652,190
Explanation:
All you gotta do is add
Which label best describes this image?
Explosive eruption—beware of ash!
Gases push out magma with great force!
Volcano quietly erupts due to low-viscosity magma!
High silica content of magma results in lava reaching sea level by morning!
The label that best describes the image is Volcano quietly erupts due to low-viscosity magma!. The correct option is c.
What are volcanoes?A volcano is an aperture or vent through which lava, tephra (small rocks), and steam are released onto the surface of the planet.
The broad-domed volcano with gently sloping sides known as the Shield Volcano is known for its frequent eruptions of fluid, basaltic lava.
A broad-topped volcano with gently sloping sides known as the Cinder Volcano is known for its frequent eruptions of fluid basaltic lava. A broad-topped volcano with gently sloping sides known as a composite volcano is one that frequently erupts with fluid basaltic lava.
Therefore, the correct option is c. Volcano quietly erupts due to low-viscosity magma!
To learn more about volcanoes, refer to the link:
https://brainly.com/question/2681336
#SPJ6
The question is incomplete. The image is added below:
Answer: C on edg : Volcano quietly erupts due to low-viscosity magma!
Dichotomous Key! Please help
Answer:
the presence of antennae
Explanation:
You are a prokaryotic cell that all of a sudden as the ability to take on 3 organelles or cell structures that you don't have, which 3 would you pick and why?
Answer:
Nucleus, mitochondrion, and chloroplast
Explanation:
If I were to be a prokaryotic cell that suddenly develops the ability to take on 3 organelles that I do not already have, I would pick a nucleus, a mitochondrion, and a chloroplast.
The presence of the nucleus would enable the freely lying genetic materials in the cytoplasm to become organized and packaged within the nucleus, thereby enabling more controls over transcription and translation processes.
Also, the presence of mitochondrion would increase the efficiency of energy generation through oxidative phosphorylation and the chloroplast will enable the cell to be able to manufacture its own food through photosynthesis rather than depending on external sources for foods.
What does the Big Bang Theory explain? -How the universe was created.
-The brightness of stars.
-How many stars there are in the Milky Way.
-The way that black holes are formed.
Calculate the increase
in the mouse population
between months 23 and 25.
Show your work.
The mouse population has increased exponentially from 23 months to 25 months. There is an increase from 0.9 to 3.4. Hence, a nearly 2.5 million rise is seen.
What is population growth?
A population is a group of similar individuals present in a particular environment. The tiger population, for example. A population growth depends upon the carrying capacity of the environment. Carrying capacity is defined as the potential of an environment to hold a population. It varies for different populations.
If the carrying capacity is lower for a population, they have a lower chance of survival in that environment. In that environment, they get less food and less space to live. They can't grow exponentially.
When a population's carrying capacity is high, it receives more food and more living space. They grow exponentially in that environment. In the mouse population, between these two months, they grow exponentially due to the proper availability of resources.
Hence, 2.5 million growth is seen in mice between these two months.
To learn more about population growth, refer the link,
https://brainly.com/question/18415071
# SPJ2
Iron is attracted to a magnet while tin is not. If a mixture of iron and tin pieces is placed near a magnet,
Answer:
The iron will separate from the tin.
Explanation:
Does it matter whether DNA sequence the mutation occurs
Both a solar eclipse and a lunar eclipse involve the alignment between the Sun,
Earth, and the Moon, but in different positions. What is the difference between a
solar eclipse and a lunar eclipse?
A: The position of the Moon and Earth are different.
B: The position of the Sun and Earth are different.
C: The position of the Sun alone is different
D: The position of Earth alone is different
Answer:
The position of the Moon and Earth are different.
What is the student doing
Answer:
Explanation:
making a prediction
There are many factors that may cause a mutation in a gene. Which of the following events would be most likely to cause a mutation?
mRNA travels out of the nucleus.
mRNA is released from the DNA strand.
A nucleotide is inserted into a DNA strand
An enzyme transcribes mRNA in the nucleus
Answer:
Since there are many factors that can produce a mutation, the event that would be most likely to cause a mutation is a nucleotide is inserted into a DNA strand.
Explanation:
A genetic mutation involves an alteration of the DNA that leads to a defect in protein synthesis and a structural or functional alteration of an individual.
Of all the factors that can produce a mutation, the insertion of one or two nucleotides into the DNA strand produces a point mutation, or molecular mutation, of the insertion type.
The other options are not correct because the processes of mRNA traveling out of the nucleus, mRNA releasing from the DNA strand or enzymatic transcription of mRNA in the nucleus can carry over a mutation produced in the DNA, but they are not mutation-producing factors.
explain eutrophication and why it isn't good for an ecosystem
Eutrophication is when the environment becomes enriched with nutrients. This can be a problem in marine habitats such as lakes as it can cause algal blooms. Some algae even produce toxins that are harmful to higher forms of life. This can cause problems along the food chain and affect any animal that feeds on them.
Hope it helps ^^
Answer:
Excessive nutrients lead to algal blooms and low-oxygen (hypoxic) waters that can kill fish and seagrass and reduce essential fish habitats. Eutrophication sets off a chain reaction in the ecosystem, starting with an overabundance of algae and plants.
Explanation:
brainliest plzz
How Do You "Win" At Natural Selection?
Answer:
choose the best option?
Explanation:
"Winning" at natural selection refers to successfully passing on one's genes to the next generation.
What is natural selection?Natural selection is a mechanism of evolution that favors traits that increase an organism's chances of surviving and reproducing. In order to "win" at natural selection, an organism must have traits that help it survive and reproduce in its particular environment.
For example, a bird with a beak that is well-suited to its particular food source is more likely to survive and pass on its genes than a bird with a less suitable beak. However, it's important to note that natural selection is not a conscious or deliberate process, and there is no "goal" or "endgame" to evolution. Instead, it is simply a description of the mechanism by which species change over time.
Learn more about natural selection, here:
https://brainly.com/question/2725702
#SPJ6
How does the sperm come in contact with frog eggs?
1. The sperm is placed on top of the eggs
2. The sperm is carried through a reproductive system
3. The sperm is carried to eggs via water
What phase of the cell cycle does DNA replicate?A. Prophase
B. Anaphase
C. Metaphase
D. Interphase
Answer:
Option - DHope it helps youMendel worked with pea plants, which are usually Choose... ( cross-pollinating or self-polllinating) .When he transferred pollen from one pea plant to another, he was Choose...(self-pollinating or cross-pollinating) the pea plants to Choose...(self-pollinating or cross-pollinating) the eggs and form embryos within a seed.
Answer:
1.) Self-Pollinating, 2.) Cross-Pollinating, 3.) Fertilize
Explanation:
Pea plants are know to self-pollinate, so when Mendel transferred pollen to one pea plant to the other, it would be called cross-pollinating. Think of it as exchanging. This allowed the pea plants to fertilize the eggs.
1.) Self-Pollinating,
2.) Cross-Pollinating,
3.) Fertilize
Mendel's seminal work was accomplished using the garden pea, Pisum sativum, to study inheritance.This species naturally self-fertilizes, meaning that pollen encounters ova within the same flower. The flower petals remain sealed tightly until pollination is completed to prevent the pollination of other plants. Pea plants are know to self-pollinate, so when Mendel transferred pollen to one pea plant to the other, it would be called cross-pollinating. Think of it as exchanging. This allowed the pea plants to fertilize the eggs.Learn more:
brainly.com/question/1483517
How does carbon dioxide affect the Earth's climate?
Carbon dioxide is being added to the soil, which causes weather phenomenon.
While carbon dioxide is in the air waiting to be reabsorbed it traps the sun's
heat.
Carbon dioxide mixes with water vapor to take harmful chemicals out of the air.
Carbon dioxide affects the Earth's climate while carbon dioxide is in the air waiting to be reabsorbed; it traps the sun's heat. The correct option is b.
What is carbon dioxide?Carbon dioxide whose chemical formula is CO2 is a chemical compound made up of molecules that each have one carbon atom covalently double bonded to two oxygen atoms. It is found in the gas state at room temperature.
In the air, carbon dioxide is transparent to visible light but absorbs infrared radiation, acting as a greenhouse gas. It is a trace gas in Earth's atmosphere at 421 parts per million, or about 0.04% by volume as of May 2022, having risen from pre-industrial levels of 280 ppm. Burning fossil fuels is the primary cause of these increased CO2 concentrations and also the primary cause of climate change. Carbon dioxide is soluble in water and is found in groundwater, lakes, ice caps, and seawater.
When carbon dioxide dissolves in water, it forms carbonic acid, which causes ocean acidification as atmospheric CO2 levels increase.
Learn more about carbon, here:
https://brainly.com/question/22530423
#SPJ6
A hand lens or magnifying glass is strong enough to view cell organelles.
True
False
A serve flood brings a lot of sediment and silt into the black river. The oxygen of the river decreases greatly. What is the r limiting factor?
Answer:
oxygen
Explanation:
A limiting factor is any condition whose decrease, increase, absence or presence is able to limit/stop population growth. Examples of limiting factors include abiotic conditions (e.g., temperature, water, oxygen, CO2, etc) or biotic conditions (e.g., food, mate, etc). There are many aquatic species that require high levels of oxygen (e.g., fish), thus being it a limiting factor for these species.
A major source of variation is mutations.
True
False
When completing a soil texture test silt particles feel? Sticky, gritty, or smooth?
Answer:
Soil texture is determined by the size and proportion of the particles that make up the soil. Every soil can be separated into three fractions – sand, silt, and clay. Sand particles are the largest and make the soil feel gritty. Silt particles are medium sized and give a smooth, floury feeling to the soil.
Uh, I hope it helps you understand? :T
PLEASE HELP DUE IN 10 MINUTES!!!!
There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).
Which type or types of RNA contain a copy of the instructions that a gene carries?
A. mRNA only
B. rRNA only
C. mRNA and tRNA
D. mRNA, rRNA, and tRNA
Answer:
A. mRNA only
Explanation:
The type of RNA that contains a copy of the instructions that a gene carries is mRNA.
RNA stands for ribonucliec acid. It is genetic material in some organisms like viruses. It is of three types, namely mRNA, rRNA and tRNA. mRNA contain a copy of the instructions that a gene carries.
What is translation?Translation is the process of formation of protein by mRNA.
In this process the gene encodes a protein, and instructions are given for making protein.
mRNA plays main role in protein synthesis, as it contain a copy of the instructions that a gene carries.
Thus, the correct option is A.
For more details regarding translation, visit:
https://brainly.com/question/16305501
#SPJ2
Plz help nobody is helping me plzzzzzzz
Answer:
24800
Explanation:
To get the velocity for this problem
we need to simply multiply the number together
124 × 200 = 24,800
Velocity equation
Hertz x meters = velocity
Which of the following explains why food is cheaper and more available now than at any time in history?
More people in developing countries are eating more grains than meat.
Farmers can produce more crops from the same amount of land.
More farmers are purchasing neighboring lands to add to their holdings.
Scientists have developed “super seeds” that are rich in energy.
Answer:
because taxes and prices in the stockmarket are going up so they have enough money so they lower the prices
Explanation:
Answer:
B: Farmers can produce more crops from the same amount of land.
Explanation:
American farms grew larger and more productive at the same time that the global demand for their crops, and the food made from those crops, accelerated. The United States exported 6,988,000 metric tons of corn in 1960. In 2007, the United States exported almost nine times that amount: 61,913,000 metric tons of corn. Corn exports have declined since 2007 because the growth of the ethanol industry has kept more of the corn crop at home. To meet the growing global demand for corn on basically the same amount of land, American farmers improved the productivity of their crops: corn yields, as measured in tons per hectare, more than doubled from 1960 to today.
Hope this helps :)
calculate the heat energy lost by the zooplankton
Answer:
2273 Is the amount of heat energy lost by zooplankton
Explanation:
8. In the beaker, the water nearest the flame becomes
Answer:
did you get the answer yet
What are two resources for which organism would compete?
Answer:
Air, food, water and space
Answer:
Organisms compete for the resources they need to survive- air, water, food, and space. In areas where these are sufficient, organisms live in comfortable co-existence, and in areas where resources are abundant, the ecosystem boasts high species richness...
Each cell needs a full instruction manual to operate properly. DNA needs to be copied before cell division so that each new cell receives a full set of instructions.However, DNA cannot begin the process by itself. Describe how the uptake of glucose can make this process take place.
Answer:
sorry but i need these points for a assignment
true or false the mitochondriion organelle is considered the " mighty power house " because it makes ATP .
Match the organisms to the description.
there’s a scorpion, starfish, octopus and a bird
the descriptions are “lacks colored blood”
“has a soft unsegmented body”
“is a vertebrate”
“lacks antennae”
Answer:
starfish has unsegmented body
bird is a vertebrate
octopus packs colored blood
scorpion lacks annternna