Please select all that apply​

Please Select All That Apply

Answers

Answer 1

Answer:

Cell renewal, growth, and asexual reproduction :)

Explanation:


Related Questions

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

Write any three differences between infectious and non- infectious disease


please its aurgent ​

Answers

Answer:

Infectious diseases are transmitted from person-to-person through the transfer of a pathogen such as bacteria, viruses, fungi or parasites. A non-infectious disease cannot be transmitted through a pathogen and is caused by a variety of other circumstantial factors.

Explanation:

NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?

2.How do you think that the one species of finch evolved into many different species, each with its own advantages?

3. In what ways do these advantages help the finches to survive and reproduce?

4. What might have happened if the finches didn't evolve into many different species?

Answers

Answer:

1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.

2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection

3.  Medium ground finches with larger beaks could take advantage of alternate food

4. three species of Darwin's tree finches have been known to inhabit Floreana  but no birds singing that song on Floreana have been heard in many years.

Explanation:

Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.

Answers

Answer:

genes are segments of chromosomes that form tight coils called dna

The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:

Genes are segments of chromosomes that form tight coils called DNA.

Thus, the correct option is D.

What is Chromosome?

A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.

Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.

Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.

All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.

Therefore, the correct option for this question is D.

To learn more about Chromosomes, refer to the link:

https://brainly.com/question/11912112

#SPJ6

Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?

Answers

Answer: The basic answer could be because of the tectonics plates.

Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.

Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.

Why are rocks folded?

Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.

Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.

Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.

Learn more about rocks, here:

https://brainly.com/question/29561452

#SPJ2

Which of the following provides the best summary of the process of natural
selection?
A. Populations become better adapted to their environment.
B. Individuals pass on their best traits to their offspring.
C. Individuals always change in response to their environment.
D. Population sizes increase with every generation.
SUBMI

Answers

Answer:

c

Explanation:

Which of these variables might affect the amount of solar
energy reaching a particular place on Earth's surface?
A. latitude
B. tilt of Earth's axis
C. time of day
D. weather conditions, such as cloud cover

Answers

Answer:

B. tilt of Earth's axis.

Explanation:

Solar radiation, or insolation, is the “fuel” of all solar energy systems. The performance of solar photovoltaic systems which generate electricity and solar thermal systems which produce hot water all depend on the availability and intensity of solar radiation.

Can someone please help me

Answers

Answer:

carbon dioxide plus water in the presence of light energy to sugar and oxygen

Number 20 Please help I will mark brainliest

Answers

Answer:

H.) The offspring will have the correct number of chromosomes when the sperm and egg are joined

Explanation:

This is because the sperm has 23 number of chromosomes and the egg has 23 number of chromosomes as well. When they fuse, they from 46 chromosomes.

Answer:

I think it is H.

before the egg and sperm join they have half of the chromosomes each when they join the chromosomes add up to the right amount which is 46

What is the relationship between a person's PULSE RATE and his or her HEART BEAT? A. The heart beat is always double the pulse rate. B. The heart beat and pulse rate may change, but are always equal. C. The heart beat is always half of the pulse rate. D. There is no relationship between the heart beat and the pulse rate.

Answers

Answer:

B. The heart beat and pulse rate may change, but are always equal.

Hope this helps :D Have a fantastic day

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

What change to the following molecule's structure would result in a saturated fat?

Answers

Answer:

It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.  

Explanation:

Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.

Hope this helped :)  

Do all cells divide at the same rate? Explain

Help

Answers

Answer:

No, all cells do not divide at the same rate. Cells that require frequent replenishing, such as skin or intestinal cells, may only take roughly twelve hours to complete a cell cycle.

Which pair of waves could overlap to produce a wave with a higher amplitude through interference?​

Answers

Answer:

D: Two waves of the same amplitude with crests that are perfectly aligned

Explanation:

A P E X

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

The diagram shows four pairs of chromosomes from the karyotype of a normal human male.
Select the pair of sex chromosomes.

Answers

Answer:

According to the karyotype image, the sex chromosomes of a normal human male are those of the last picture, where both are different.

Explanation:

The sex chromosomes are those that determine the sex in a species, as in the human being and other species X and Y. XY chromosomes determine the male sex while the XX sex pair corresponds to the female sex.

In humans, the chromosomes are grouped by pairs with the same characteristics, that is, most pairs of chromosomes are identical. The only exception is represented by the male human sex chromosomes X and Y. This difference in the sex chromosomes causes the different sex chromosomes (picture) to be called heterogametic.

The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!

Answers

Answer:

The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell

Explanation:

Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.

What is Plasma Membrane?

Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.

The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.

The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.

Therefore, correct option is A.

Learn more about Plasma membrane here:

https://brainly.com/question/24588191

#SPJ5

What does the lunar rover do?
O moves astronauts around
O gives air to astronauts
O makes space rocks

Answers

The answer is the first one

Moves astronauts around

please help me!! 15 points!

Answers

More fossils found were of larger oranisms than of dinosaurs

The cell part that helps with cell division is the ________​

Answers

Answer:

centrioles

Explanation:

Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.

what would happen if an electric fish was always negatively charged instead?​

Answers

Answer:

Electric eels are part of a group of animals called electric fish.These cells pump positively charged sodium atoms, called ions, from inside themselves to the outside.

Explanation:

Brainliest? plz

Electric fish is a part of the group of animals which are responsible for producing charge. These organisms pump positively charged sodium ions from inside themselves to the outside environment.

What is electric fish?

An electric fish is an fish that can generate electric fields and transfer current through themselves. Most of the electric fishes are electroreceptive, which means that these fishes can sense the electric fields present in the environment. The only exception here is the stargazer family which is not electroreceptive.

The examples of electric fish includes Electric eel, that belongs to the genus Electrophorus, South American knifefishes responsible for the production of powerful electric shocks to stun prey.

If the electric fishes are supplied with the negative charge always then they will pump positive charge to neutralize the effect of that charge.

Learn more about Electric fish here:

https://brainly.com/question/14788080

#SPJ2

Lloyds lab partner is looking down into a test tube while he hears the contents by using a flame. Which action should Lloyd recommend to his partner if heating must continue?

Answers

Answer:

To stop looking throught the test tube. lol

Explanation:

When the dry and wet bulb temperatures are far apart. the humidity is high.
True
False

Answers

the answer is false purrr

together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?​.​

Answers

Answer: The spread of Christianity among the Jews was the heroic act of San Vitores.

Explanation:

He was murdered on the island of Guam on 2 April 1672. He brought Christianity to the CHamoru people. He was killed  by the chief's daughter Mata' pang with a sword. His conversion efforts were commendable. The CHamorus people  welcomed San Vitores and hundreds of people were readily converted into Christians readily. Today Catholism is the main religion in Guam.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

Which chemical bond most likely stores the most energy?
A. C=C
B. C-C
C. H-H
D. H-O

Answers

Answer:

The chemical bond which stores more energy is the Double carbon-carbon bond.

Explanation:

9. The Sun's outward pressure of radiation is balanced by an inward pressure provided by
gravity
O fusion
fission
oxidation

Answers

Im pretty sure is fusion correct me if im wrong

Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis

Answers

I think it is C but uh if its not D Hope this helps-

Explanation: because

What would be the concern if a high percentage of cells were in some phase of Mitosis?

Answers

Answer:

When cell division goes wrong, harmful mutations affect the daughter cells

When these errors are not corrected, one of the daughter cells will be born lacking a particular chromosome while the other will inherit an extra copy of the chromosome

Explanation:

first one to answer gets brain

Answers

Answer:

I believe the printing press

Explanation:

the printing press was invented around 1440

Other Questions
create a flowchart to print numbers from 1 to 100( IF U ANSWER PROPERLY I WILL MARK U AS BRAINLIEST) i will give brainlest to the first person to answer this question: While at the grocery store, Mrs. Martin noticed that there were two different sized bottles of hot sauce, one was 16.9 ounces and the other 32.55 ounces. What is the difference in weight of the two bottles of hot sauce? Question: How does Vice President-elect Kamala Harris present a new image of political leadership? just kidding I got it already A video game store was getting rid of old games, selling them 5 for $73.50. If they sold 3 games, how much moneh would they have made? PLEASE HELP! BRAINLIEST! POINTS!Which verb or verb phrase signals an inappropriate shift in mood?I think Daniel SHOULD BECOME a plumber. He WOULD BE ABLE TO OWN his own business. He might even hire others to work for him someday. As a plumber, he could make a lot of money. He COULD HELP OUT his friends and family with plumbing problems. WILL YOU GIVE us a discount on plumbing work, Daniel?A. would be able to ownB. could help outC. should becomeD. Will you give Select all irrational numbers. What are the solutions of 8x2 = 6 + 22x? Check all of the boxes that apply. What do we call a number that when we squared the result is negative? find the angle of yzv? A newly formed firm must decide on a plant location. There are two alternatives under consideration: locate near the major raw materials or locate near the major customers. Locating near the raw materials will result in lower fixed and variable costs compared to locating near the market, but the owners believe there would be a loss in sales volume because customers tend to favor local suppliers. Revenue per unit will be $179 in either case. Revenue per unit will be $183 in either case. Using the following information, determine which location would produce the greater profit. Omaha Kansas cityAnnual fixed costs ($ millions) $1.2 $1.4Variable cost per unit $36 $47 Expected annual demand (units) 8,000 12,000 How did humans modify the environment during Industrial Revolution?A. Humans changed the environment by planting trees on a wide scale in urban areas.B. During the revolution, humans tore down buildings that had been on the land for hundreds of years.C. Humans changed the landscape by building many factories that polluted the air and environment.OD. Humans mass produced goods and made them available to large populations in urban areas. 6(n-3)-2n=10solve n Solve for m: 63 + 91 + 3m > 180 5+2x+6=x +10 Solve this equation and show ur work how is groundwater impacted by urban sprawl? 9 + 1 + ___________ = 14 What areas were the focus of disagreement between the United States and the Soviet Union? Select three options.cultureeconomicsideologylanguagepolitics Michael is purchasing back to school supplies. He gets a math workbook for $19.88, a calculator for $35.97, and a pack of pencils for $8.27. How much did he spend on school supplies? What is the difference between perimeter and area of polygons?