Question in picture

Question In Picture

Answers

Answer 1

Answer 1:formation of mountain ranges

Hope this helps have a great day!!

Explanation:


Related Questions

if an electric motor uses 50 kj of energy to do 46 kj of work, how efficient is it

Answers

Answer:

8%

Explanation:

Efficiency = 1 - Q1/Q2

= 1 - 46/50

= 1 - 0.92

= 0.08

= 8%

7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?

BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'

5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5

Answers

Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.

What are restriction sites?

Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.

Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.

Examples of restriction enzymes are Bam1 and EcoR1.

For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'

Two bands will be produced using Bam1 as shown below:

5'ACGAATTCAGTATTATCCTAGG 3'

3'TGCTTAAGTCATAATAGGATCC 5'

5'TATCCGCCGCCGAATTCTCATCA 3'

3'ATAGGCGGCGGCTTAAGAGTAGT 5'

For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'

Three bands will be produced using with EcoR1 as shown below:

5'ACGAATTC 3'

3'TGCTTAAG 5'

5'AGTATTATCCTAGGTATCCGCCGCC 3'

3'TCATAATAGGATCCATAGGCGGCGG 5'

5'TCATCA 3'

3'AGTAGT 5'

Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.

Learn more about restriction sites at: https://brainly.com/question/8886948

What does the term “evolution” mean to you

Answers

Answer:

In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.

Explanation:

Answer:

evolution means the making of judgement about the amount number or value of something

which statement BEST describes the reason for the change in the cell membrane model?

The new model was the result of a vote by scientists.

The new model help scientist avoid more research.

The new model came from more experiments and evidence.

The new model is based on the researchers best guess.

Answers

Answer:

The new model came from more experiments and evidence.

Explanation:

As more research and better technology came out scientists were able to update to a more accurate model.

how was earth created ?

Answers

Answer:

Formation.

Explanation:

Earth formed when gravity pulled swirling gas and dust in to become the third planet from the Sun.

can you make an example sentence of a physical change?​

Answers

Answer:

when water turns into ice.

Explanation:

it changes the physical phases of matter.  

Answer:

Lila put some ice cubes in a tray and left them out on the kitchen counter for thirty minutes. When she came back the ice was melted, so she had to put them back in the freezer to refreeze.

Explanation:

A physical change is a generally reversible change. Eg. Ice melting, dissolving sugar and water, and boiling water are all examples of physical change!

Hope this helps :)

The 16s rRNA gene encodes an RNA that would be used as a component of the _________ during ____________.

a. RNA polymerase, transription

b. a protein, DNA replication

c. the ribosome, translation

d. tRNA, DNA replication

Answers

The 16s rRNA gene encodes an RNA that would be used as a component of the ribosome during translation (Option c). It is a ribosomal RNA.

What are ribosomal RNAs?

Ribosomal RNAs (rRNAs) represent fundamental components of the ribosomes, the protein factories of the cell.

Ribosomes play central roles during the process of translation by which an mRNA is used as a template to produce a polypeptide.

The 16S rRNA is a constituent of the bacterial small ribosomal subunit, which is used during translation.

Learn more about ribosomal RNAs here:

https://brainly.com/question/930760

During the cell cycle,chromatin will undergo changes in packing . State the two forms of chromatin and relate its structure to the process of DNA replication.​

Answers

Chromatin exists in two forms. One form, called euchromatin, is less condensed and can be transcribed. The second form, called heterochromatin, is highly condensed and is typically not transcribed. Under the microscope in its extended form, chromatin looks like beads on a string.

Pa brainliest po


4. What is the carrying capacity of Wildebeest in the Serengeti?

Answers

Answer:

1,300,000

Explanation:

Explain that this limit is called the carrying capacity, and that it is the largest population size that the environment can support in the long run.

What is the best description of a biome? a An interdependent system of plants, animals, and land. b A system of trees, forests, and rivers. c A habitat where large numbers of animals live. d An area with significant amounts of rainfall.

Answers

A biome can be best described as an interdependent system of plants, animals, and land.
Option A is the correct answer

However, it is a habitat or large area which is characterised by its vegetation, soil, climate, and animals.

Answer:

A

Explanation:



HELP PLEASE I NEEED THIS RIGHT NOW

Answers

Why do butterflies like flying to different places after the atmosphere changes it’s weather and why do butterflies likes certain weather in the atmosphere


Not sure if it’s asking questions but correct me if I’m wrong

Which of the following can be the product of an expressed gene?

• DNA
• Protein
• Chromosome
• Part of a Protein
• a switch telling other genes when to expresses or not


TEXT REFERENCE HERE ➪

Answers

Answer:

part of a protein

Explanation:

part of a protein

6. In the food chain shown, which animals are prey? (Select all that apply.)
grass
grasshopper
frog
snake
eagle

Answers

Answer:

Grasshopper and frog.

Explanation:

Hope this helps.

Answer:frog, snake, eagle

Explanation:

Input of energy in most communities comes from the
sun
A. phytoplankton of the oceans
B.
C. tropical rainforest
D. agricultural productivity

Answers

Answer:

A: phytoplankton of the ocean

Can someone please tell me if this is the right order

Answers

Yes I guess this is the right order

Even though individuals only have two alleles for any given gene, there may be many different alleles for that gene within the human population. What is the term for this phenomenon?
Group of answer choices

Multiple alleles

Genetic diversity

De novo mutation

Allelic variety

Answers

Answer:

Genetic diversity

Explanation:

Genetic diversity is when a population of a species, humans, in this case, have different genes between different individuals. One person may have blue eyes while the others have brown. This shows diversity within the gene pool.

Genetic diversity is also important to the survival of a species. Two-parent reproduction leads to genetic diversity. Having different alleles within a population allows for adaptation. On the other hand, one-parent reproduction does not allow for genetic diversity. This hinders the species because it does not let species to slowly improve the gene pool through natural selection and adaptation.

The ileum has an acidic environment due to the presence of hydrochloric acid.
true or false​

Answers

Answer:

true

Explanation:

Compare and contrast each of the following pairs of terms: (a) circulatory system and cardiovascular system, (b) complete blood count and complete blood count with differential.

Answers

The circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.

What is circulatory system and cardiovascular system?

The cardiovascular system covers those structures (heart and blood vessels) that allow blood and lymphatic circulation (circulatory system).

What is a complete blood count?

It is a scheme that allows to represent the composition of the blood.

What is a complete blood count with differential?

It is one of the tests that allows counting each of the leukocyte types.

Differences between circulatory system and cardiovascular system, complete blood count and complete blood count with differential

Circulatory system and cardiovascular system are linked to the set of organs and structures that allow blood and lymph to travel through the body.

A complete blood count examines the types and numbers of cells in the blood: white blood cells, red blood cells and platelets by performing a blood count of these main cells.

A complete blood count with differential is used to diagnose and monitor many different conditions, including anemia measuring the percentages of each type of white blood cell.

Therefore, we can conclude that the circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.

Learn more about circulatory and cardiovascular system here: https://brainly.com/question/1023001

I NEED HELP ASAP What is the best explanation for how the position of the ball changes after each second?


The force of gravity speeds up the ball.


The force of friction speeds up the ball.


The force from the girl's hand slows down the ball.


The force of gravity slows down the ball.

Answers

Initially the force from the girls hand speeds up the ball. And when it’s at its zenith (highest point) the force of gravity pulls it towards the earth and speeds the ball up.

Of those four the first explains it best
Probably the force of gravity speeds up the ball

What is a role of a scientist?

A to report accurate results

B to keep scientific secrets

C to tell people how the must
live

D to dictate government policy

Answers

The answer is (A)
Hope this helps

• Seasonal movement to a different geographical region where
conditions are more favorable

Answers

Answer:

Maybe a more warm location???

Explanation:

Can someone please help me with this I’ll give u brain list !!

Answers

Answer:

Here u go ;)

Explanation:

Livestock :- animals that are kept for the goods they offer and that can be sold for profit

Overharvesting :- catching or removing from a population more organisms than the population can replace

Aquaculture :- involves raising aquatic organisms for human use

Drought :- lack of water in an area causing crops to die

Famine :- the social and economic crisis in a given area that is commonly characterized by widespread malnutrition, starvation, etc.

Malnutrition :- when an organism does not consume enough nutrients needed to fulfill the body's needs

Diet :- The type and amount of food a person eats

Pesticides :- Chemicals that protect crops from harmful plants and insects

Carbohydrates :- Primary source of energy for the body

Erosion :- the wearing away of soil by wind and water

is fission radioactive ?
I NEED HELPPP

Answers

Answer:

yes

Explanation:

i took the test

Answer:

Yes it is 'The fission products themselves are usually unstable and therefore radioactive'

Explanation:

Source: wikipedia

identify the main function of a stereo dissection microscope

Answers

Answer: Allows a magnified 3-Dimensional perspective when dissecting. This enables more accuracy in movements.

Explanation:

How might evidence obtained from genetic counselors change the lives of families?

Answers

Answer:

Genetic counseling can help you proactively identify genetic risk factors, based on an expert review of your personal and family health histories.

Explanation:

A genetic counselor can help you get appropriate genetic testing and address risks through personalized medical recommendations for you and your doctor to put into action.

i need an explanation for this myth i have made for my science assignment "why are fish and plants not in the same phylum"​

Answers

Answer:

They can't be in the same phylum because they are in two different categories on the basis of Mode of nutrition. Plants are autotrophs, while animals are heterotrophs. Cell wall is present in plant cells, while it is absent in animal cells.

Explanation:

A phylum is a major group of animals or in some classifications plants sharing one or more fundamental characteristics that set them apart from all other animals and plants/

A soccer player has been sprinting up and down the field. She is breathing
very hard and has a burning sensation in her muscles. Which of these is the
most likely cause of the burning in her muscles?
A. Fermentation produced too much lactate due to anaerobic
conditions.
B. Glycolysis produced too much pyruvate due to aerobic conditions.
C. The Krebs cycle used up too much carbon dioxide.
D. Electron transport chains produced too much ATP.

Answers

A is closest.

Lactic acid build up that’s a byproduct of because of anaerobic respiration (occurs when there’s not sufficient oxygen to oxidise the glucose).
The correct answer is A) “Fermentation produced too much lactate due to anaerobic conditions.”

Can someone please help me with this I’ll give u brain list just please !

Answers

Natural Selection show that the animals will survive based on there genetics

What are the 4 components of natural selection?

Answers

variation, overpopulation, reproduction, competition

What evidence is there that the bat and dolphin share a common ancestor? Explain how the two species could be so different.​

Answers

Answer:

I hope the below helps!

Explanation:

Scientists have noticed similarities between a bat's wings and a dolphin's flippers.

Fossil records also show that the 2 animals have the same/similar skeletal elements. These skeletal elements have evolved into different shapes and sizes based on their function. For example, the flipper of a dolphin is adapted for swimming and the wing of a bat is adapted for flying.

This evidence shows that the 2 species are distantly related and share a common ancestor.

Other Questions
How many groups of 2 are in 7 explain your answer what would happen if America didn't annex of Hawaii Laker Company reported the following January purchases and sales data for its only product. The Company uses a perpetual inventory system. For specific identification, ending inventory consists of 190 units from the January 30 purchase, 5 units from the January 20 purchase, and 20 units from beginning inventory. Compute gross profit for the month of January for Laker Company for the four inventory methods. (HELP ME ASAP PLEASE) In the following diagram, A || B.Use complete sentences to explain how the special angles created by the intersection of A and B by D can be used to solve for x.Solve for x, showing all of your work.Find the measure of 6. Please help anyone????!! women doing ballet sometimes dance on their _____ to create an illusion of a weightless appearance A. toesB. noseC. motor PLSSSSSSSSSSSS HELP MEEEEE 3. The area of quadrilateral ABCD is 12 sq. units. Find X. write equation in standard form Zee leave his house at 08:45 and arrives at school at 10:06. How long was her journey? When analysts in Western cultures use the word fundamentalism in connection with the Middle East, they primarily mean _____.the churchsocietythe worlda political systemmarital What is the definition of success? Winning all the time Taking action to grow your Can Do Circle Having a lot of friends Having nothing in your Not Yet Circle How many times greater is the productof 5x20 compared to 10x20? Solve the system of equations: x+4y-z=6 2x+11y+4z=9 x+5y+z=5 The Seneca Falls Convention in New York was meant to address the issue of. Question 11 options: Mental Health Temperance Movement Women's Rights Abolition of Slavery. The graph of a system of two equations is a pair of parallel lines. Does the system have a solution? ExplainPLEASE HELP A historian using the skull of periodization will: essay about why immigrants benefit the US and why its good. and why people say immigrants are bad. 4 paragraph, 8 sentences in each. please please please help Kaylee is a high school basketball player. In a particular game, she made some two point shots and some three point shots. Kaylee scored a total of 24 points and made 3 more three point shots than two point shots. Graphically solve a system of equations in order to determine the number of two point shots made, x,x, and the number of three point shots made, yy.how would you graph this? A6 m ladder leans against the side of a house. The bottom of the ladder is 2 m away from the side of the house. Find X, the angle of elevation of the ladder.Round your answer to the nearest tenth of a degree.PLEASE HELP