Solve using the quadratic formula: 2x^2 + 5x + 1

Answers

Answer 1

Answer:

x = -0.22   or x = -2.28

Step-by-step explanation:

2x^2 + 5x + 1 = 0

You use the quadratic formula: -b ±√5² - 4 x 2 x 1 ÷ (2 x 2)

-5 +√17 ÷ 4 = -0.22

-5 - √17 ÷ 4 = -2.28


Related Questions

Jack wants to lose some weight and is highly motivated to follow the orders of his doctor. His doctor has given him a goal that he is to decrease his weight by 2 3/8 pounds per week. If Jack weighs 250 pounds
when he starts the diet, how much will he weigh after five weeks on the
diet?

Answers

Answer:

The answer would be 11 7/8 pounds

Step-by-step explanation:

2 3/8 times 5 equals 11 7/8.

Hope I helped!! :)

Sorry if it's wrong! :(

Pls mark brainlist.

graph the function r(x) = -1/4 |x|

Answers

here is your function graphed

Simplify: −5(−4) + 13 =

Answers

Answer:

33

Step-by-step explanation:

-5(-4)= 20

20+13=33

Mr. Demers is making a drink by adding flavor drops to his water. If he puts 3 drops in a 12 ounce glass of water, how many ounces does he use PER DROP?

Answers

Answer:

Step-by-step explanation: if he puts 3 drops in a 12 ounce glass of water he should be using 4 ounces per drop 12 ounces divided by 3 drops gives you 4 ounces per drop

Answer: 4 ounces per drop

=======================================================

Explanation:

"Per drop" means "per 1 drop" or "for each 1 drop".

We start off with the ratio of

3 drops: 12 ounces

Divide both parts of that ratio by 3 so that "3 drops" turns into "1 drop"

Doing so gets us the new ratio of

1 drop: 4 ounces

So he uses 4 ounces per drop.

Find the missing angle​

Answers

Answer: 137degrees

Step-by-step explanation:

So we know that a complete angel has 360 degrees within. So in this case, all we need to do is use 360 and subtract 167 and 56 from it.

360-167-56= 137

Hey there!

The answer is 109

We can see that both angles make 167, so 167 - 56 = 109 is remaining angle

Which is greater A or B

Answers

Answer:

I'ma assume B because it's the only graph I see

What is the opposite of -1/2

Answers

Answer: 1/2

Step-by-step explanation:

Just remove the negative

1/2? Is the opposite of 1/2?

please help! i will give brainliest.

Answers

Answer:

a) Math and Dance

b) 3 students (Chau, Juan, Ivan)

c) Tome, Jose, Josh, Rita

Step-by-step explanation:

That was so easy homework :-) write in comments if it helped

What is the lenth of BD

Answers

Answer: 8

Step-by-step explanation:

That is your answer

what is 0.41891891891892 to two significant figures?

Answers

Answer:

0. 42

Step-by-step explanation:

any number greater than 0 is significant if it's exactly 0 or less than 0 is not significant. since it's two significant figures you count the first two numbers greater than 0 which is 0.41 and we have 8 will is greater than 5 which will be rounded to 1 then rounded to 0.41 which makes it 0.42

I NEED HELP PLEASE I DON’T WANT TO FAIL PLEASE PLEASE HELP ME

Answers

The slope is 4/3 because when the y axis increases by four, the x axis increases by three. The y intercept is -2 because the line intercepts the y axis at -2. This means that it’s equation would be y=4/3-2. I hope this helps :)

help please i have an f!!

Answers

Answer:

1x=3y

-9x=-2y

Step-by-step explanation:

6x=-4y

17x=-2y

4y

17x=-2y

The m∠4 = 5x - 3° and m∠5 = 3x + 17°. Find the value of x.

Answers

Answer:

why

Step-by-step explanation:

HELP ILY A tree is 4 1/2 feet tall. It is expected to grow by 1 3/4
feet per year.
At this growth rate, how many years will it take for the tree to have a height greater than 40 feet? Enter the answer in the box.
years

Answers

Answer:

It will take 21 years.

Step-by-step explanation:

First, find what x would be for it to equal 40 feet. This can be done with the equation 4.5 + 1.75x = 40.

4.5 + 1.75x = 40

Subtract 4.5 from both sides. This cancels out the +4.5.

1.75x = 40 - 4.5

Subtract 4.5 from 40 to get 35.5.

1.75x = 35.5

Divide both sides by 1.75. This cancels out the *1.75.

x = 35.5/1.75

Expand 35.5/1.75 by multiply both the numerator and denominator by 100.

x = 3550/175

Reduce 3550/175 by canceling out 25.

x = 142/7 = 20 2/7

Go up by one from 20 to get the answer of 21 years.

A football player has made 80% of the field goals he has attempted in his career. If he
attempts 45 field goals in a season, how many would he be expected to make?

PLEASE ANWSER SERIOUSLY

Answers

Answer:

im pretty sure its 56.25 cus 45= 80% of 56.25

Step-by-step explanation:

What is the value of b if (3 + i) and (3 - i) are complex roots of 2x² + bx + 20 = 0?

A. -12
B. -6
C. 6
D. 10

Answers

A is the answer Bc I did this before and my teacher said I did an excellent job!

I need some help...-^-

George rented a bike for 4 hours there was a $10 deposit to pay in addition to the hourly rate what is the hourly rate if the total came to less than or equal to $65...

Answers

Answer:

y=13.75x+10

Step-by-step explanation:

65-10=55

55 divided by 4 is 13.75

Answer:

y=13.75x+10

Step-by-step explanation:

65-10=55

55 divided by 4 is 13.75

A catapult’s lever holds a cannonball. The lever is attached to a tightly held rope. When the rope is released, the lever springs forward and launches the cannonball. When the rope is held tightly, which form of energy does it possess?​

Answers

Answer:

elastic

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

Need Help ASAP
Please help with this math question i dont understand it very well.

Answers

Answer:

-30h +40 - 60 I think.........

Express in the form 1: n.
Give n as a decimal.
8 : 6

please help ​

Answers

Answer:

n = 0.75

1 : 0.75

Step-by-step explanation:

To get from 8 to 1, you have to divide by 8. You do that to the number 6.

6/8 = 3/4 = 75/100.

Therefore, n = 0.75.

prove the circle centered at A la congruent to the circle centered at C. ​

Answers

Answer:

Huh!

The circles with of same radii or same circumference or same area are congruent.

No need to proof!

Step-by-step explanation:

Or just type it,

'Since they have the same radii, they are congruent!'

The two given circles are congruent as their radius are similar.

What is a circle?All points in a plane that are at a specific distance from a specific point, the center, form a circle. In other words, it is the curve that a moving point in a plane draws to keep its distance from a specific point constant.A circle is a closed, two-dimensional object where every point in the plane is equally spaced from a central point. The line of reflection symmetry is formed by all lines that traverse the circle. Additionally, every angle has rotational symmetry around the center.

So, the two circles are congruent because:

We know that:

AB = CDAnd AB and CD are the two radius of the given two circles.Since their radius is similar.

So, the two circles will be congruent.


Therefore, the two given circles are congruent as their radius are similar.

Know more about circles here:

https://brainly.com/question/24375372

#SPJ2

170,000,000 in scientific notation

Answers

Answer:

1.7×10^8

hope it helps.

Jessica wants to buy a new chair that has a regular price of $75.00. This week the chair will be on sale at a 12% discount.
How much money will Jessica save if she buys the chair this week?

Answers

Answer:

$9

Step-by-step explanation:

She will save $9 because the amount 75 so 12% of 75 is 9 and that 9 is the amount you save.

n=1,064÷28
anyone knows the answer \

Answers

I think the answer is 38

Answer:

n=38

Step-by-step explanation:

can somebody help me ?

Answers

Answer:

6

Step-by-step explanation:

24/4 is 6

Answer:

6 US dollars

Step-by-step explanation:

I'm not mcsmart sorry

Solve the equation:
−8n−8=−72

Select one:

n=−20

n=−2

n=8

n=17

Answers

Answer: n=8

Step-by-step explanation:

N=8, I showed the work your welcome

HELP ASAP PLEASE
List the coordinates for the plotted points A, B, C, and D.

Answers

Answer:

Use Desmos

Step-by-step explanation:

Plz help me on this :))

Answers

X is 4 if I am correct
The function is
Y=2|x-2|+4

While completing a DLA test virtually, Deidra answered 8 out 30 questions incorrectly. If the ratio remains constant, how many questions should Deidra answer correctly out of 45 questions?

Answers

Deidra should get 33 questions correct and 12 questions incorrect if she completes a tests with 45 questions.

If the ratio of incorrect questions to total questions is 8:30, that can be simplified down to 4:15.

There are 3 15's in 45 so you need to multiply 4 by 3 to get 12 incorrect answers.

To work out the amount of correct answers, you need to take the incorrect answers away from the total questions.

Answer:

I wnat to say its 19

Step-by-step explanation:

Solve for x:
7x = 105

Answers

Answer:

X=15

Explanation: You have no like terms to combine and are at the last step of the algebraic equation. So, you would divide 7 on both sides. 7 by 7 cancels it out and 105 divided by 7 equals 15. Hope this helps ^-^.

The solution to the equation 7x = 105 is x = 15.

We have the equation: 7x= 105

To solve for x in the equation 7x = 105, we need to isolate x on one side of the equation.

Divide both sides of the equation by 7:

(7x)/7 = 105/7

Simplifying:

x = 15

Therefore, the solution to the equation 7x = 105 is x = 15.

Learn more about Equation here:

https://brainly.com/question/29538993

#SPJ6

Other Questions
I need help!!!!!!!!!!!!!!!!!!!!!!!!!!!! :) Three (3) movie tickets cost $36. At this rate, what is the cost perticket?O $18$33O $12O $108 Select the correct answer.Susan is planning to create a vector mask for an image. What editing tools can Susan use to create a vector mask? .a Pen tool or a Shape toolOB.a Painting tool or a Select toolOC.a Dodge tool or a Burn toolOD.a Type tool or a Type Mask tool What would be the final step to applying your customized voting butons in Outlook messages?O Type your new choices in the Text Bar.O Click on Voting Buttons and choose Custom.O Open the Voting Buttons menu and choose your customized choices.O Click Submit and your custom voting choices will appear in the message body. 320 grams of brass released 5000 J of heat. If it has an initial temperature of 50C, what is its temperature after releasing the heat? The specific heat capacity of brass is 376 J/kg. * Harvesting wood from forests is one the top industries in the world. There are various ways for loggers to harvest this wood. Which of the following would provide the best sustainable use of the land?A. Strip cutting the trees because only mature trees are cutB. Clear cutting the trees because it is the most cost effective methodC. Clear cutting the trees because it produces the greatest timber yieldD. Strip cutting the trees because it minimizes widespread destruction decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA Read the conclusion from the Declaration of Sentiments. Then, answer the question.1What is Elizabeth Cady Stanton demanding?2She wants women to become US citizens.3She wants women to have special privileges.She wants women to have all the rights they are due as US citizens.In view of the unjust laws above mentioned . . . we insist that [women] have immediate admission to all the rights and privileges which belong to them as citizens of the United States.- Declaration of Sentiments1848 According to sea wolf which quotation from the excerpt most clearly helps to build tension by portraying an external conflict Please help me plot this True or False: The moon does not have anatmosphere, plants, animals or oceans. 30 POINTS!!!! As you read the paragraph below, decide how relevant each detail is.The two rowers carefully held both sides of the boat. One at a time each rower climbed into the boat and sat in her seat. When both rowers were in place, they grabbed the oars beside them. The oars were long and made of wood. The rowers pushed away from the dock.Which fact above is the least relevant?Select one:a.When both rowers were in place, they grabbed the oar beside them.b.The oars were long and made of wood.c.One at a time each got on and sat in their seat.d.The two rowers carefully held both sides of the boat. What are some similes and metaphors from "The Polar Express"? 163-x=-52 equals what as the answer Notre Dame Cathedral located in Paris, France is most closely associated with-A) HinduismB) JudaismC) BuddhismD) Christianity Who does Odysseus see in the underworld?a. Laertesb. Polyphemusc. Anticleiad Antinous Hi please help me answer this :) Explain answer Will give braisnlt What was the main reason for Henry VIIIs split from the Roman Catholic Church? what is the distance between these numbers TOGETHER Help! please I'm not sure what it is please i really need help for my final