TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer 1

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.


Related Questions

Is gooseberry monocot or dicot​

Answers

Dicot mark me brainliest please thank you

Answer: dicot

Explanation: I think

explain the process of digestion abd absorption of carbohydrates.​

Answers

Answer:

Carbohydrate digestion breaks down disaccharides (sugar) and complex carbohydrates into a simpler sugar so it can be absorbed. But not all are completely absorbed in the small intestines.

Explanation:

How could natural selection affect humans?

Answers

Answer:

Explanation:

an example is the ability to endure the sugar, lactose, in milk. In many places of the world, people can't drink milk in light of the fact that their body turns off the intestinal creation of lactase, a chemical that processes the sugar in the milk.

Answer:

Natural selection is still influencing the evolution of a wide variety of human traits, from when people start having children to their body mass index, reports a study published Monday in the journal Proceedings of the National Academy of Sciences.

Explanation:

15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations​

Answers

Answer:

C. Somatic

Explanation:

hope it helps ya :D

A mutation in E. coli is found that fails to induce the lac operon even when IPTG is added (IPTG is an inducer of the lac operon that enters the cell by passive diffusion). Which of the following could explain this phenotype (you may choose one or more answers)?

a. Mutation in the promoter of the lac operon.
b. Mutation in the operator of the lac operon.
c. Mutation in the repressor for the lac operon.
d. Mutation in the Z gene for beta galactosidase.
e. Mutation in the Y gene for Lac permease.
f. Mutation in the gene for adenylate cyclase.
g. Mutation in the gene for CAP (or CRP) protein h) Mutation in the gene for rho factor
i. None of the above

Answers

I think this answer would be...

Your mom

How would the soil biota be afected by using traditional chemical pesticides and would this difer from using transgenic methods

Answers

Answer:

The impact of pesticides on soil biota can be either positive or negative, depending on the type of pesticide used. Genetically modified organisms (GMOs) are generally designed in order to be more resistant to pesticides, thereby GMOs might have a higher impact on the soil biota (however, the evidence is not conclusive and case by case should be evaluated)

Explanation:

Traditional chemical pesticides are chemical substances used to control pests (e.g., insect pests affecting corn yield). Examples of traditional chemical pesticides include 2,4-Dichlorophenoxyacetic Acid, DDT, Atrazine, Chlordecone, etc. The impacts of these traditional pesticides on soil biota are variable according to the type of product used, the rate at which these products are applied, the target/non-target soil biota (e.g., bacteria, algae, fungi, protozoa, insects, nematodes). For example, it has been reported long-term contamination of DDT on soil microflora (i.e., microalgae and cyanobacteria), thereby these non-target species declined with increasing DDT use; however, direct effects on fungi populations were not observed. Genetically modified organisms (GMOs) are organisms whose DNA has been engineered by using molecular biology techniques. In crop improvement, GMO plants are designed to be more resistant to chemical pesticides and also to produce pesticides themselves, for example, Bt crops that produce a toxin from Bacillus thuringiensis (Bt) that can kill insect pests. GMO plants can also be designed to be more resistant to pesticides, thereby affecting soil biota at higher scale values. Nonetheless, it is important to highlight that like chemical pesticides, the effects of GMOs on soil biota are also variable depending on the type of GMO, which pesticide GMO is producing, target/non-target soil species, etc.

Explain the difference between how light falls on the Earth near the Equator or the Poles

Answers

Answer:

Explanation:

The normal amount of solar radiation reduces from the Equator to the poles. This is because the low latitudes (near the Equator deliver relatively large amounts of radiation all year, and at high latitudes (near the poles), the more slanting angle of the Sun’s rays together with long periods of darkness in the winter, result in a low amount of received radiation.

What is the importance of Mitosis in both Prokaryotic and Eukaryotic Cells

Answers

Answer:

Mitosis is the process by which the overwhelming number of cell divisions in eukaryotic organisms occur. Eukaryotes (animals, plants and fungi) typically consist of literally trillions of cells, and at any time, countless worn-out, dead or irreparably damaged body cells need to be replaces. Mitosis is the eukaryotic answer to binary fission in the single-celled prokaryotes, which is similar on the surface but simpler at the level of details.

Explanation:

Which populations are least affected by density-dependent factors?

Answers

the denjsjdjsjsjsjsjss

At what points in the progression from gene to protein do these methods act (i.e., what processes do they prevent)

Answers

Answer:

Genes are translated, transcribed and after these two steps, the formation of a protein takes place.

DNA is translated, that is, read, in the form of codes and thanks to the machinery of intracellular transcriptases, after this an RNA is encoded that will be made with the assembly of amino acids that together will form proteins.

Proteins can be structural or functional.

Explanation:

There are different methods to intervene in these processes, it can be by means of macromolecules, drugs and also by microbiological factors, that is, by microorganisms such as viruses that take advantage of the human transcription machinery to replicate.

Which characteristics describe cnidarians? Check all that apply.
O Cnidarians are vertebrates.
O Cnidarians are invertebrates.
O Cnidarians come in a single body form.
Cnidarians come in two possible body forms.
Some cnidarians can reproduce sexually.
All cnidarians can reproduce asexually.

Answers

Answer:

2. Cnidarians are invertebrates.

4. Cnidarians come in two possible body forms.

5. Some cnidarians can reproduce sexually.

6. All cnidarians can reproduce asexually.

Explanation: I took the test and I got it correct

Answer: the person above me is 100% correct.

Explanation: i got 100% on the quiz.

What is the definition of "earth overshoot day?"

Answers

Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.

What he saiddhdhshshshshdhdjdjdjdjdjd

A student is using a terrarium like the one shown here to study the cycling of
water in an ecosystem.
Which observation would be the best evidence of the water cycle?
O A. Condensation
O B. Predation
O C. Moving animals
O D. Dead plants

Answers

Answer:

A- condensation

Explanation:

Condensation would be the best evidence of the water cycle in a terrarium ecosystem.  Therefore, option (A) is correct.

What is water cycle?

The water cycle is the continuous movement of water between the Earth's surface, atmosphere, and underground. It involves several processes, including evaporation, transpiration, condensation, precipitation, and runoff.

In the water cycle, water evaporates from the Earth's surface into the atmosphere, where it cools and condenses into clouds. These clouds can then produce precipitation, such as rain, snow, or sleet, which falls back to the Earth's surface. Some of this precipitation is absorbed by plants or runs off into rivers, streams, and lakes, while the rest seeps into the ground to become groundwater. This groundwater can eventually be released back to the surface through springs, or it can flow into larger bodies of water.

The water cycle is a vital process for the Earth's ecosystems, as it helps to distribute water and nutrients across the planet and support life. Human activities, such as deforestation and pollution, can disrupt the water cycle and have negative impacts on the environment.

Learn more about water cycle, here:

https://brainly.com/question/1151425

#SPJ7

In 1956 Tijo and Levan first successfully counted human chromosomes. The reason it would have taken so manyyears to have done so would have included all but which of the following?

a. Watson and Crick's structure of DNA was not done until 1953.
b. Chromosomes were piled up on top of one another in the nucleus.
c. Chromosomes were not distinguishable during interphase.
d. A method had not yet been devised to halt mitosis at metaphase.

Answers

Answer:

A

Explanation:

The correct answer would be that Watson and Crick's structure of DNA was not done until 1953.

The fact that chromosomes are condensed together in the nucleus, are not distinguishable during interphase, and a method had not yet been devised to halt mitosis at metaphase could have plausibly delayed the successful counting of human chromosomes.

On the other hand, the discovery of the structure of the DNA could not have delayed the study of chromosomes because the DNA structure has no bearing on the karyotyping of chromosomes.

The chromosomes of organisms are best studied using a relevant microscope during metaphase when they would have fully decondensed and align at the equator of the cell or the metaphase plate. At the interphase phase of the cell cycle, chromosomes are full condensed under the view of the microscope.

The correct option is, therefore, A.

3.4.3 Lab: Why are cells so small?

Answers

Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.

Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.

The cells are so small because their small size allows them to take in food and get rid of the waste.

The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.

Learn more about cell:

https://brainly.com/question/3142913

I really need someone who is good at biology please

Answers

Answer:

What's the question?

Answer:

whats the question

Explanation:

5. Objects that sink have a greater density than the buoyant force acting on it.
(3 Points)
True
False

Answers

Answer:

FALSE

Explanation:                                   JFNHHNNFHNHIJGJNHJINNJIGNJINRTIHNNEJIRTNHNJENRTJIHNJIENIJRTJHINERTNERNTHNEIRNTNEJRNFJINRJTNHFINRTJIHNFIJENRTJHNEJIRTNHJNFEIJNHNETNFHJNRTJHNFEJRNTJIHNFEINTRJHINERNTH

when a carbohydrate chain is attached to a protein what is the structure called​

Answers


Glycoproteins are proteins which contain oligosaccharide chains (glycans) covalently attached to amino acid side-chains. The carbohydrate is attached to the protein in a cotranslational or posttranslational modification. This process is known as glycosylation. Secreted extracellular proteins are often glycosylated.

Which statement best describes Mendel's principle of segregation?​

Answers

Answer:

Inherited traits are controlled by two factors that separate during reproduction.

Explanation:

What is a global hectare (gha)?

Answers

Accounting unit of ecological protection

Question 20 of 26
How many daughter cells does mitosis produce?
A) 2.
B) 4
C) 23
D) 46

Answers

The answer is 4. Hope this helps

Answer:

A) 2.

I hope it helps :)

Explanation:

During mitosis, a eukaryotic cell undergoes a carefully coordinated nuclear division that results in the formation of two genetically identical daughter cells. Mitosis itself consists of five active steps, or phases: prophase, prometaphase, metaphase, anaphase, and telophase.

What is the independent variable?
What is the dependent variable?

Answers

I need more context please

what are the parts of the brain

Answers

Answer:

Cerebrum. Cerebellum. Brain stem.

Explanation:

**anatomy & physiology question**

if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?

Answers

Answer:

0.8mm.

Explanation:

If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.

5. What would our planet be like without plants?​

Answers

Answer:

we would die plants give us oxgen fruits and vegtebales  . trees for example we need wood and there leaf to make  doors and paper

Explanation:

If the planet didn’t have plants, we would be lacking in fruits and vegetables. We probably wouldn’t be too healthy. We would also be lacking in oxygen as things like trees give us oxygen. The trees also enable people to make doors and even paper. If we didn’t have trees, we probably would struggle with getting privacy since (doors) allow us to keep a boundary from people you wouldn’t want to go in (say like in your bedroom or home even.)

I hope this makes some sense

The most common presenting sign/symptom with rheumatic fever is a. rash. b. painless nodules. c. polyarthritis. d. cardiac murmur.

Answers

Answer:

c. polyarthritis.

Explanation:

Rheumatic fever is an inflammatory disease that may affect different parts of the body including joints, heart, brain, and skin. It is a rare disease observed after a bacterial throat infection caused by Streptococcus (group A). The most common signs of this disease include swollen and/or tender joints (i.e., polyarthritis), especially in wrists, knees, elbows or ankles, fever, fatigue, pain in the chest, breathlessness, palpitations, etc. Rheumatic fever needs to be treated by antibiotics to eliminate group A Streptococcus infections.

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

What is the major difference during cytokinesis in eukaryotes with or without a cell wall?

Answers

Answer:

Cytokinesis in eukaryotic animal cells do not have a cell wall, it occurs through a strangulation process carried out from the plasma membrane, this process is called segmentation. Plant cells are characterized by cytokinesis based on septate, since the cell wall does not allow strangulation.

Explanation:

Cytokinesis means: cell division, it is a cellular process parallel to mitosis whose purpose is the division of the stem cell's cytoplasm between daughter cells. In animal cells, cytokinesis occurs by cleavage. At the end of anaphase and during telophase, the central part of the cell narrows, forming the segmentation groove, which deepens (strangulation). Plant cells, as they lack centrosomes, will form the achromatic spindle from two polar caps. In this case, cytokinesis does not occur by strangulation, but a cell wall is formed between the two daughter cells. This septum, called a fragmoplast, is formed from vesicles from the Golgi apparatus.

The major difference during cytokinesis in eukaryotes with or without a cell

wall is in the formation of cell plate in cells with cell wall while in animal

cells cytokinesis occurs through the formation of a cleavage furrow.

Cytokinesis is the process of cell division in which the cytoplasm divides

into two. Plants have cell walls while animals lack cell walls.

Animal and plant cells form cleavage furrow and cell plate respectively

which aids division into two equal parts.

Read more about Cytokinesis here https://brainly.com/question/5615155

CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST THANK YOU

Answers

Answer:

The answer is

A. methane

The diagram below represents a top view of a river a emptying into an ocean bay. A - B is a reference line along the bottom of the bay. Which characteristic would most likely decrease along the reference line from A to B? (1) the amount of salt in solution (2) the size of the sedi ments (3) the density of the water (4 ) the depth of the water

Answers

Answer: D

Explanation: it’s the size of the sediments

Other Questions
The picture shows respiratory epithelium in the lungs. The cilia, or fingerlike projections are MOST LIKELY there toA)move liquid.B)catch debris.C)secrete mucus.D)transmit impulses joe boght 15 tolets. 1 was pure gold 2 were pure silver and the rest were wooden. how many wooden toilets were there? Drivers ED. An inflamed stomach and a poorly-functioning pancreas __________. Does anyone know pls help... could you help me with this question Explain how the legislative branch has checks on the three branches of government. The sum of the perimeters of 2 different squares is 68 feet, and the difference between their perimeters is 12 feet. What is the side length ofeach square? Helppp me faststttttt plzzzzz Question 17 (True/False Worth 1 points)Alead is found at the beginning of a news story.O TrueO False Find ABDA5x B 4x + 3 CAB Why is it important to respect other political opinions?OA. It allows politicians to gain new voters,B. It creates a more informed electorate,Oc. It helps citizens change their minds on political issues,OD. It leads to improvements in the education system. This political cartoon is from a California newspaper in the late 1800s.Which conclusion can be drawn from this illustration?American citizens were targets of discrimination.Americans opposed immigration from Europe.Nativists opposed immigration from Asian nations.Nativists discriminated against American Indians. What is evil and can trick you In one paragraph, name two specific challenges thatpeople on the Balkan Peninsula face. What is a cause ofthese challenges? Which sentence below is tariff used correctly? A. All states charge a tariff B. A tariff is charged to mail a letter C. Americans are required to pay a tariff at the airport D. A tariff was added to the Chinese imports. A.it is a function B.it is not a function How was Hitler able to gain votes? Group of answer choicesthe people wanted another warthe people believed in Hitler's vision and were anxious to target Jewsthe people in Germany liked the promise of a stronger country and the Nazi agenda was left out of the campaignthe people didn't really pay attention to what Hitler stood for Solve for z.Please help! what is the y-intercept of the following equation is the black death airborne ?? apparently it isnt but then why did ppl use those masks ?