Answer:
Population, community, or environment
Explanation:
It depends on if you are asking the amount of the same species, the place they live in, or if you are asking different organisms
If you are talking about the same species than the answer is population
If you are talking about different species interacting it would be community
If you are talking about the place in which they live, it would be environment :)
Hope this helps, I'm just a little confused on the question :)
What three systems work together to make an animal move about?
a: nervous system, digestive system, muscular system
b: nervous system, skeletal system, muscular system
c: nervous system, circulatory system, muscular system
d: nervous system, digestive system, circulatory system
Answer:
B:nervous system,skeletal system,muscular system
Compare and contrast each of the following pairs of terms: (a) circulatory system and cardiovascular system, (b) complete blood count and complete blood count with differential.
The circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.
What is circulatory system and cardiovascular system?The cardiovascular system covers those structures (heart and blood vessels) that allow blood and lymphatic circulation (circulatory system).
What is a complete blood count?It is a scheme that allows to represent the composition of the blood.
What is a complete blood count with differential?It is one of the tests that allows counting each of the leukocyte types.
Differences between circulatory system and cardiovascular system, complete blood count and complete blood count with differentialCirculatory system and cardiovascular system are linked to the set of organs and structures that allow blood and lymph to travel through the body.A complete blood count examines the types and numbers of cells in the blood: white blood cells, red blood cells and platelets by performing a blood count of these main cells.A complete blood count with differential is used to diagnose and monitor many different conditions, including anemia measuring the percentages of each type of white blood cell.Therefore, we can conclude that the circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.
Learn more about circulatory and cardiovascular system here: https://brainly.com/question/1023001
i need an explanation for this myth i have made for my science assignment "why are fish and plants not in the same phylum"
Answer:
They can't be in the same phylum because they are in two different categories on the basis of Mode of nutrition. Plants are autotrophs, while animals are heterotrophs. Cell wall is present in plant cells, while it is absent in animal cells.
Explanation:
A phylum is a major group of animals or in some classifications plants sharing one or more fundamental characteristics that set them apart from all other animals and plants/
which statement BEST describes the reason for the change in the cell membrane model?
The new model was the result of a vote by scientists.
The new model help scientist avoid more research.
The new model came from more experiments and evidence.
The new model is based on the researchers best guess.
Answer:
The new model came from more experiments and evidence.
Explanation:
As more research and better technology came out scientists were able to update to a more accurate model.
Can someone please tell me if this is the right order
Can someone please help me with this I’ll give u brain list just please !
The 16s rRNA gene encodes an RNA that would be used as a component of the _________ during ____________.
a. RNA polymerase, transription
b. a protein, DNA replication
c. the ribosome, translation
d. tRNA, DNA replication
The 16s rRNA gene encodes an RNA that would be used as a component of the ribosome during translation (Option c). It is a ribosomal RNA.
What are ribosomal RNAs?Ribosomal RNAs (rRNAs) represent fundamental components of the ribosomes, the protein factories of the cell.
Ribosomes play central roles during the process of translation by which an mRNA is used as a template to produce a polypeptide.
The 16S rRNA is a constituent of the bacterial small ribosomal subunit, which is used during translation.
Learn more about ribosomal RNAs here:
https://brainly.com/question/930760
What is a role of a scientist?
A to report accurate results
B to keep scientific secrets
C to tell people how the must
live
D to dictate government policy
A soccer player has been sprinting up and down the field. She is breathing
very hard and has a burning sensation in her muscles. Which of these is the
most likely cause of the burning in her muscles?
A. Fermentation produced too much lactate due to anaerobic
conditions.
B. Glycolysis produced too much pyruvate due to aerobic conditions.
C. The Krebs cycle used up too much carbon dioxide.
D. Electron transport chains produced too much ATP.
How would you take plant
lifespan type into account when
planning a garden?
Answer:
Explanation:
Annuals-replant every year
Biennale-Won’t flower the first year planted and need to be replanted after their second year of growing
Perennials- will grow back each spring
Annuals-replant every year as the Biennale won’t flower the first year planted and need to be replanted after their second year of growing and Perennials- will grow back each spring.
What is five kingdom classification?The main purpose of the classification of the Five kingdom has been known R.H. Whittaker. The five kindoms that has were included in this proposal were the Fungi, Protista, Monera.
Animalia as well as the kingdom Plantae. There are mainly five criteria or the conditions based on which the classification has been madeup of. These criteria has been includes the structure of the cell, as well as the nutrition mode, organisation of the thallus, or the relations of reproduction and phylogenetic.
Based on shoe characteristics they were to develop a classification hierarchy of shoes, beginning with the shoe "kingdom" and becoming more and more specific, just like scientists did for the classification of living things.
Therefore, Annuals-replant every year as the Biennale won’t flower the first year planted and need to be replanted after their second year of growing and Perennials- will grow back each spring.
Learn more about kingdom on :
https://brainly.com/question/14688752
#SPJ2
The ileum has an acidic environment due to the presence of hydrochloric acid.
true or false
Answer:
true
Explanation:
HELP PLEASE I NEEED THIS RIGHT NOW
What does the term “evolution” mean to you
Answer:
In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.
Explanation:
Answer:
evolution means the making of judgement about the amount number or value of something
What are the 4 components of natural selection?
if an electric motor uses 50 kj of energy to do 46 kj of work, how efficient is it
Answer:
8%
Explanation:
Efficiency = 1 - Q1/Q2
= 1 - 46/50
= 1 - 0.92
= 0.08
= 8%
Fill in the blanks in Diagram 9. Complete the diagram by writing the names of the pathways in the
ovals and the names of the molecules in the boxes.
To fill the blanks you have to know that the IUPAC nomenclature or name,is a molecule's most expanded chain of carbons, connected by one bonds
IUPAC nomenclatureGenerally, as seen the question requires the IUPAC nomenclature of a certain compounds
Therefore,IUPAC nomenclature or name is a molecule's most expanded chain of carbons, connected by one bonds, also making reference to its form of bond chain or ring e.g 2,5,5-trimethyl-2-hexene
For more information on Molecules
https://brainly.com/question/19922822
Which of the following can be the product of an expressed gene?
• DNA
• Protein
• Chromosome
• Part of a Protein
• a switch telling other genes when to expresses or not
TEXT REFERENCE HERE ➪
Answer:
part of a protein
Explanation:
part of a protein
how was earth created ?
Answer:
Formation.
Explanation:
Earth formed when gravity pulled swirling gas and dust in to become the third planet from the Sun.
is fission radioactive ?
I NEED HELPPP
Answer:
yes
Explanation:
i took the test
Answer:
Yes it is 'The fission products themselves are usually unstable and therefore radioactive'
Explanation:
Source: wikipedia
During the cell cycle,chromatin will undergo changes in packing . State the two forms of chromatin and relate its structure to the process of DNA replication.
Chromatin exists in two forms. One form, called euchromatin, is less condensed and can be transcribed. The second form, called heterochromatin, is highly condensed and is typically not transcribed. Under the microscope in its extended form, chromatin looks like beads on a string.
Pa brainliest po
a strong acid would most likely have a pH of ?
a. 14
b. 1
c. 7
d. 10
Answer:
B. 1
Explanation:
What is the best description of a biome? a An interdependent system of plants, animals, and land. b A system of trees, forests, and rivers. c A habitat where large numbers of animals live. d An area with significant amounts of rainfall.
Answer:
A
Explanation:
I NEED HELP ASAP What is the best explanation for how the position of the ball changes after each second?
The force of gravity speeds up the ball.
The force of friction speeds up the ball.
The force from the girl's hand slows down the ball.
The force of gravity slows down the ball.
7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?
BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'
5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5
Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.
What are restriction sites?Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.
Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.
Examples of restriction enzymes are Bam1 and EcoR1.
For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'
Two bands will be produced using Bam1 as shown below:
5'ACGAATTCAGTATTATCCTAGG 3'
3'TGCTTAAGTCATAATAGGATCC 5'
5'TATCCGCCGCCGAATTCTCATCA 3'
3'ATAGGCGGCGGCTTAAGAGTAGT 5'
For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'
Three bands will be produced using with EcoR1 as shown below:
5'ACGAATTC 3'
3'TGCTTAAG 5'
5'AGTATTATCCTAGGTATCCGCCGCC 3'
3'TCATAATAGGATCCATAGGCGGCGG 5'
5'TCATCA 3'
3'AGTAGT 5'
Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.
Learn more about restriction sites at: https://brainly.com/question/8886948
Can someone please help me with this I’ll give u brain list !!
Answer:
Here u go ;)
Explanation:
Livestock :- animals that are kept for the goods they offer and that can be sold for profit
Overharvesting :- catching or removing from a population more organisms than the population can replace
Aquaculture :- involves raising aquatic organisms for human use
Drought :- lack of water in an area causing crops to die
Famine :- the social and economic crisis in a given area that is commonly characterized by widespread malnutrition, starvation, etc.
Malnutrition :- when an organism does not consume enough nutrients needed to fulfill the body's needs
Diet :- The type and amount of food a person eats
Pesticides :- Chemicals that protect crops from harmful plants and insects
Carbohydrates :- Primary source of energy for the body
Erosion :- the wearing away of soil by wind and water
4. What is the carrying capacity of Wildebeest in the Serengeti?
Answer:
1,300,000
Explanation:
Explain that this limit is called the carrying capacity, and that it is the largest population size that the environment can support in the long run.
identify the main function of a stereo dissection microscope
Answer: Allows a magnified 3-Dimensional perspective when dissecting. This enables more accuracy in movements.
Explanation:
• Seasonal movement to a different geographical region where
conditions are more favorable
Answer:
Maybe a more warm location???
Explanation:
can you make an example sentence of a physical change?
Answer:
when water turns into ice.
Explanation:
it changes the physical phases of matter.
Answer:
Lila put some ice cubes in a tray and left them out on the kitchen counter for thirty minutes. When she came back the ice was melted, so she had to put them back in the freezer to refreeze.
Explanation:
A physical change is a generally reversible change. Eg. Ice melting, dissolving sugar and water, and boiling water are all examples of physical change!
Hope this helps :)
Input of energy in most communities comes from the
sun
A. phytoplankton of the oceans
B.
C. tropical rainforest
D. agricultural productivity
Answer:
A: phytoplankton of the ocean
