Answer:
True
Explanation:
I also like your profile picture
The lymphatic system consists of lymphatic vessels and ducts, lymph nodes, and spleen. The immune systems consist of bone marrow. Hence, statement true.
What is immune system?The system that helps to fight infections and diseases with the help complex system of tissues, cells, organs is called as immune system.
In humans, immunity is of 3 types including:
adaptive immunity- natural immunityinnate immunity- develops throughout lifepassive immunity- borrowed from any source that doesn't last long.Bone marrow and the thymus are primary parts of the immune system. Bone marrow play significant role in production of blood cells including B and T lymphocytes. In also includes organs of lymph system such as lymph node, thymus, spleen, tonsils, lymph node, and lymph vessels.
Therefore, The statement above is true.
Learn more about immune system, here:
https://brainly.com/question/19843453
#SPJ3
When the dry and wet bulb temperatures are far apart. the humidity is high.
True
False
why are bacteria good for copying large amounts of dna
Answer:Bacteria become ‘factories’ that produce a large number of copies of the recombinant DNA. There are several reasons for the use of bacteria as the host in the recombinant DNA technology. They are; Bacterial cells are easy to grow, maintain, and manipulate in a laboratory.
Explanation:You might wanna change some words i just found it somewhere
Some chemical reactions release energy. Others store energy. What important chemical reaction stores energy?
Answer: endothermic reaction.
Explanation: A chemical reaction that stores energy is called an endothermic reaction. More energy might be released as products form than the energy needed to break the reactants apart.
Chemical reactions which release energy are called Exothermic reaction whereas the reaction which store energy are called Endothermic reaction. The energy is stored in the form of chemical bonds.
What is Chemical reaction?A chemical reaction is a process in which chemical transformation of one set of substance is converted into another type of substance.
Chemical reactions are of two types on the basis of energy transfer: Exothermic reaction and Endothermic reaction. An exothermic reaction is the chemical reaction in which the product is formed with the release of energy in the form of heat. For example: Breakdown of glucose through cellular respiration. An endothermic reaction is the chemical reaction in which the product is formed which stores energy in the form of chemical bonds. For example: The formation of glucose.
Learn more about Energy here:
https://brainly.com/question/1371184
#SPJ6
please help me!! 15 points!
Lloyds lab partner is looking down into a test tube while he hears the contents by using a flame. Which action should Lloyd recommend to his partner if heating must continue?
Answer:
To stop looking throught the test tube. lol
Explanation:
together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?.
Answer: The spread of Christianity among the Jews was the heroic act of San Vitores.
Explanation:
He was murdered on the island of Guam on 2 April 1672. He brought Christianity to the CHamoru people. He was killed by the chief's daughter Mata' pang with a sword. His conversion efforts were commendable. The CHamorus people welcomed San Vitores and hundreds of people were readily converted into Christians readily. Today Catholism is the main religion in Guam.
If a tRNA molecule has an anticodon which reads CAG, what was the codon on the mRNA molecule?
(4 points)
answers:
AUG
GTC
UAG
GUC
Answer:
GUC
Explanation:
The base sequence for tRNA will be the complement of the mRNA sequence:
tRNA: CAG
mRNA: GUC
Answer:
GUC
Explanation:
Can someone please help me
Answer:
carbon dioxide plus water in the presence of light energy to sugar and oxygen
Number 20 Please help I will mark brainliest
Answer:
H.) The offspring will have the correct number of chromosomes when the sperm and egg are joined
Explanation:
This is because the sperm has 23 number of chromosomes and the egg has 23 number of chromosomes as well. When they fuse, they from 46 chromosomes.
Answer:
I think it is H.
before the egg and sperm join they have half of the chromosomes each when they join the chromosomes add up to the right amount which is 46
What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]
When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.
Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis
I think it is C but uh if its not D Hope this helps-
Explanation: because
Put the following in the correct order from smallest (#1) to largest (9)
Organ
[ Select ]
Tissue
[ Select ]
Atom
[ Select ]
Organelle
[ Select ]
Macromolecule
[ Select ]
Cell
[ Select ]
Organ system
[ Select ]
Molecule
[ Select ]
Organism
Answer:
atom
Explanation:
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.
Answer:
genes are segments of chromosomes that form tight coils called dna
The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:
Genes are segments of chromosomes that form tight coils called DNA.Thus, the correct option is D.
What is Chromosome?A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.
Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.
Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.
All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.
Therefore, the correct option for this question is D.
To learn more about Chromosomes, refer to the link:
https://brainly.com/question/11912112
#SPJ6
Write any three differences between infectious and non- infectious disease
please its aurgent
Answer:
Infectious diseases are transmitted from person-to-person through the transfer of a pathogen such as bacteria, viruses, fungi or parasites. A non-infectious disease cannot be transmitted through a pathogen and is caused by a variety of other circumstantial factors.
Explanation:
first one to answer gets brain
Answer:
I believe the printing press
Explanation:
the printing press was invented around 1440
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
The diagram shows four pairs of chromosomes from the karyotype of a normal human male.
Select the pair of sex chromosomes.
Answer:
According to the karyotype image, the sex chromosomes of a normal human male are those of the last picture, where both are different.
Explanation:
The sex chromosomes are those that determine the sex in a species, as in the human being and other species X and Y. XY chromosomes determine the male sex while the XX sex pair corresponds to the female sex.
In humans, the chromosomes are grouped by pairs with the same characteristics, that is, most pairs of chromosomes are identical. The only exception is represented by the male human sex chromosomes X and Y. This difference in the sex chromosomes causes the different sex chromosomes (picture) to be called heterogametic.
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
A cactus with the genotype Kkww is crossed with a cactus with the genotype KKWw. Which of the following genotypes will be shared by 25% of the offspring?
A. KKWW
B. kkWw
C. KKww
D. KkWW
Answer: C
Explanation: Think of it this way, which ever has the most is what answer would be. So they come across 3 capitals with K its gonna be KK not kk.
Hope this helps
The genotype is defined as the genetic makeup of an organism, or the set of alleles. The cross between Kkww and KKWw will result in 25% of the progeny having genotype KKww.
The correct option is:
Option C. KKww
Find the attachment for the Punnett square, given below.
The cross between Kkww and KKWw will result in the gametes as:
Kkww - Kw, Kw, kw, kwKKWw - KW, Kw, Kw, kwThe progeny having genotype as KKww will be 4 or 25%.
Therefore, Option C is correct.
To know more about cross and Punnett square, refer to the following link:
https://brainly.com/question/14642557
What would be the concern if a high percentage of cells were in some phase of Mitosis?
Answer:
When cell division goes wrong, harmful mutations affect the daughter cells
When these errors are not corrected, one of the daughter cells will be born lacking a particular chromosome while the other will inherit an extra copy of the chromosome
Explanation:
The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!
Answer:
The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell
Explanation:
Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.
What is Plasma Membrane?Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.
The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.
The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.
Therefore, correct option is A.
Learn more about Plasma membrane here:
https://brainly.com/question/24588191
#SPJ5
The primary function of DNA is to
(ONLY ANSWER IF YOU KNOW ITS RIGHT)
direct RNA to make lipids
store and transmit genetic information
control chemical processes within the cell
prevent mutations
what would happen if an electric fish was always negatively charged instead?
Answer:
Electric eels are part of a group of animals called electric fish.These cells pump positively charged sodium atoms, called ions, from inside themselves to the outside.
Explanation:
Brainliest? plz
Electric fish is a part of the group of animals which are responsible for producing charge. These organisms pump positively charged sodium ions from inside themselves to the outside environment.
What is electric fish?
An electric fish is an fish that can generate electric fields and transfer current through themselves. Most of the electric fishes are electroreceptive, which means that these fishes can sense the electric fields present in the environment. The only exception here is the stargazer family which is not electroreceptive.
The examples of electric fish includes Electric eel, that belongs to the genus Electrophorus, South American knifefishes responsible for the production of powerful electric shocks to stun prey.
If the electric fishes are supplied with the negative charge always then they will pump positive charge to neutralize the effect of that charge.
Learn more about Electric fish here:
https://brainly.com/question/14788080
#SPJ2
Do all cells divide at the same rate? Explain
Help
Answer:
No, all cells do not divide at the same rate. Cells that require frequent replenishing, such as skin or intestinal cells, may only take roughly twelve hours to complete a cell cycle.
What does the lunar rover do?
O moves astronauts around
O gives air to astronauts
O makes space rocks
Which of the following provides the best summary of the process of natural
selection?
A. Populations become better adapted to their environment.
B. Individuals pass on their best traits to their offspring.
C. Individuals always change in response to their environment.
D. Population sizes increase with every generation.
SUBMI
Answer:
c
Explanation:
Please helpme ASAP :)))) BRAINLIST I WILL
Answer:
1. Respiratory System
2. - Not sure -
3. - not sure -
4. Endocrine system
Sorry if I didnt't help much, this is all I know! Don't mark me brainliest if you don't want to :D
Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?
Answer: The basic answer could be because of the tectonics plates.
Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.
Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.
Why are rocks folded?Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.
Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.
Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.
Learn more about rocks, here:
https://brainly.com/question/29561452
#SPJ2
7. B=brown eyes
b= blue eyes
What is true about these two brothers that have brown eyes:
One has genotype BB the other Bb.
a. they have same phenotype and genotype
b. they have different genotypes and phenotypes
c. they have same phenotype but different genotypes
d. they have same genotype but different phenotypes
The truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb). So, the correct option is C.
What do you mean by Genotypes?Genotypes may be defined as a given set of alleles that an individual possesses. They are ultimate combinations of alleles.
In this situation, the allele B is dominant over the allele b, therefore, in both cases, phenotypes remain the same i.e. Brown eyes, but the genotypes differ. This defines how an allele interacts with another allele and changes the genotype.
Therefore, the truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb).
To learn more about Gene interaction, refer to the link:
https://brainly.com/question/25217589
