Answer:
Paramecium protozoa
Explanation:
because of their size (50-300 μ long) and the human eye can see things as small as about 100 µm and P.
what is a cell that is the source of other cells
Answer:
stem cells
Explanation:
Practice 5: Match the statement ends to the beginnings
A Shell
D. Cell wall
B. Provides protection and support for the cell
E. Controls what goes into and out of the cell
C. Cell membrane
1. All cells have a
2. Plant cells have a
3. The cell membrane
4. The cell wall
5. The cell wall's function is similar to, or like a
Answer:
A-4. the cell wall
D-5. the cell walls function is similar to, or like a
B-2. plant cell have a
E-3. the cell membrane
C-1. all cell have a
6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.
which of the following correctly identifies the inheritance patterns arnoldo is observing?
the yellow allele is incompletely dominant...
Explanation:
The yellow allele is incompletely dominant.
What is Inheritance pattern?Genetic variation distribution in families is characterized by inheritance patterns. Predicting disease risk in a patient's family requires an understanding of these patterns.
Conditions brought on by pathogenic variations in a single gene are referred to as monogenic or Mendelian conditions.
Depending on the pattern of inheritance, a gene may be influenced by either one or both alleles.
Therefore, The yellow allele is incompletely dominant.
To learn more about Inheritance, refer to the link:
https://brainly.com/question/14930526
#SPJ6
What are the products of photosynthesis?
A. Water and oxygen
B. Glucose and oxygen
C. Carbon dioxide and water
D. Carbon dioxide and glucose
Answer:
B. Glucose and oxygen are the products of photosynthesisExplanation:
I hope it helps ❤️❤️What causes weathering A. natural processes only B. chemical processes only
C. Weather related processes only D. physical and chemical processes
Answer:
I believe that the answer is A. Natural processes only, although I could be wrong.
Explanation:
There are two types of weather, mehanical and chemical, but I think the answer is A.
n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water
50% water and 50% vinager
1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.
Answer/Explanation:
During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.
But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.
if an object is 3 AU from the sun, it is
Answer:
That probably refers to asteroids.
Explanation:
There is a large belt of asteroids between the orbits of Mars and Jupiter.
Is energy used or not?
Answer:
Explanation:
energy is used, everything uses energy especially living organisms
Answer:
Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.
Explanation:
Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?
Answer:
The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.
Explanation:
It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.
Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.
One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.
When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?
PLZ ANSWER !!! DUE TODAY!!!!
what do molecules and ions move with in passive transport ?
Answer:
Also called facilitated transport or passive-mediated transport, facilitated diffusion occurs when molecules or ions are processed through spontaneous passive transport. The ions and molecules are moved across a biological membrane through certain transmembrane integral proteins.
Explanation:
There ya go!! Brainliest plss!! :))))
............................Please help ASAP ........................
Answer:
I think answer choice D
Explanation:
The passage summarized says that ostriches and rheas look exactly the same but are different sizes, therefore answer choice D is auto eliminated
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
Don’t comment unless you want a lot of notifications!!!
What are you if your Mexican black Asian white Hawaiian
Answer:
A human
Explanation:
Identify the advantages and disadvantages of internal and external fertilization
9. Place the events in the correct order:
1. DNA polymerase adds nucleotides in the 5' to 3' direction
2.Replication fork is formed
3. DNA polymerase attaches to the primer
4. Okazaki fragments are bound together by ligase
5. DNA helicase unwinds DNA
ligaset
The correct order of events of DNA replication is as follows:
DNA helicase unwinds DNAReplication fork is formedDNA polymerase attaches to the primerDNA polymerase adds nucleotides in the 5' to 3' directionOkazaki fragments are bound together by ligaseDNA REPLICATION:
DNA replication is the process by which the DNA of a living organism is multiplied into two identical copies. DNA is a double-stranded molecule, hence, it must first be separated into two single strands in order to be replicated. The following are the orderly steps involved in DNA replication:An enzyme called DNA helicase unwinds DNA into single strands. A Y-shaped structure called replication fork is formed by the two single strands.DNA polymerase attaches to the primer, which is a short segment of RNA. DNA polymerase adds nucleotides to the leading strand of DNA in the 5' to 3' directionOkazaki fragments, which are small fragments of DNA are bound together by ligase enzyme and added to the lagging strand.Learn more at: https://brainly.com/question/16464230?referrer=searchResults
carlos made a diagram to compare two kinds of fish. which label belongs in the area marked Z?
a. scales
b. no jaw
c. swim bladder
d. skeleton made of bones
PLEASE HELP
Answer:
B
Explanation:
i also do edge
Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these
Answer:
all of these :)
Explanation:
i think
Answer:
Yes The Correct answer is ( All Of These)
explanation:
what is a global fire
Answer:
a wild fire of a spreading fire that reaches a global span
Explanation:
HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ
Answer:
01). cells
02).seeing inside the cells
03).Robert hook
At which type of technonic plate boundary is a volcano least likely to occur
Answer: A
coz its just sliding one another
Hope it is correct
^_^
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
2. Which of the following is a physical property of matter that is always the same regardless of size
or amount?
A. Mass
B. Volume
C. Density
D. Solubility
HELP
Answer:
A
Explanation:
Since the law of conservation of mass is valid under all circumstances, hence, mass always remains the same, whether a substance undergoes physical change or chemical change
I’m not sure if anyone knows this or not, can someone try and help me with this question!
Answer:
it gives them a mental picture of where they need to plant and pick the cotton
Explanation:
Hope this helps
Plz help me its only 1 question
Answer:
the first one
Explanation:
the car slowly started and accelerated
Its the second one. Since its continually accelerating.
Whats number 9 and 10? It’s okay if you only do one..please help..
Equations for help:
K= C + 273
C= 5/9 (F - 32)
F= (C * 9/5) + 32
Answer:
9) 75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.
10)Since, 102.2°F is greater than 100°F, Stephen can't go to school today.
Explanation:
9) First, we want to find out 24°C converted to Fahrenheit
What we want to find Equation
24°C = ?°F F= (C * 9/5) + 32
Second, we have to input our number into our equation
F = (24 × 9/5) +32
Next, we have to use the PEMDAS strategy (ask in the comments if you don't understand!)
24 × 9/5 =
24 × 9 = 216 216÷5 = 43.2
1 × 5 = 5
Now, we can't forget to add 32!
43.2 + 32 = 75.2°F
24°C = 75.2°F
75.2°F is less that 82°F so the water is not warm enough for Emma to swim in.
10) For this problem, I'm going to just show the math, so if you have any questions feel free to ask in the comments!
Step 1) 312 = C + 273
-273 -273
Step 2) 39 = C or C = 39
Step 3) F = (39 × 9/5) + 32
Step 4) F = (351/5) + 32
Step 5) F = 70.2 + 32
Step 6) F = 102.2
Since, 102.2°F is greater than 100°F, Stephen can't go to school today.(and should think about getting a regular thermometer ;)
Hope this Helps! :)
Have any questions? Ask below in the comments and I will try my best to answer.
-SGO
What is the cause of the toxic algae overgrowth in Prospect Park lake?
Phosphorus in the NYC tap water that feeds the lake. Phosphorus is put in the water to prevent lead from leaching into NYC's tap water.
Nitrogen from all of the dog poop surrounding the lake.
Combined sewage outfalls.
(This is 7th grade science).
Answer:
Harmful Algal Blooms (HABs) are produced by naturally occurring cyanobacteria in lakes and ponds, including the Prospect Park Lake and other bodies of water in the NYC area.
Explanation:
there is non
a cell with 12 chromosomes under goes mitosis, how many daughter cells are formed?
a. 2
b. 6
c.12
d 24
Answer:A
Explanation:
