What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

Answer 1
A. I hope this hopes

Related Questions

The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1)

Answers

Answer:

The no. of heterozygous carriers = 0.0392

Explanation:

From the given information:

The incidence of this recessive disorder i.e. q² = 1/2500

q² = 0.0004

q = 0.02

From Hardy Weinberg's Equilibrium.

p + q = 1; &

p² + 2pq + q² = 1

p + 0.02 = 1

p = 1 - 0.02

p = 0.98

So, the numbers of heterozygous carrier 2pq is:

= 2 × 0.98 × 0.02

= 0.0392

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

In a simulation of genetics, a child inherits either a dominant or recessive
allele from each parent. Which of the following would be the best method for
randomly determining which of two possible alleles a child inherits from the
father?
A. Drawing from a deck of cards printed with either an uppercase or
lowercase a
B. Blindly selecting from a bag filled with blue, green, red, and yellow
beads
C. Throwing a dart at a dartboard hanging on a wall at a distance of
10 feet
D. Rolling a six-sided number cube and using the number on the top
side
SUBMIT
PREVIOUS
No

Answers

The gene inherited from the father is best obtained by rolling a six-sided number cube and using the number on the top side.

What is genetics?

Genetics is the science that seeks to study the patterns of inheritance in individuals. It deals with the study of genes which often occur in pairs called alleles.

The best way to determining which of two possible alleles a child inherits from the father is rolling a six-sided number cube and using the number on the top side.

Learn more about genetics: https://brainly.com/question/9813642

Answer:

A. Drawing from a deck of cards printed with either an uppercase or

lowercase a
or
A. Drawing from a deck of cards printed with either an uppercase or

lowercase Q

Explanation:

problems one and two

Answers

Answer: 1.) 6.84m

2.) 6,510 m/s

Explanation:

Explain which processes take place during meiosis that lead to variation in inherited traits.

Answers

Answer:

We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.

A wave carries from one place to another. Mechanical waves carry energy through

Answers

Answer:

Mechanical waves bring energy from one place; the media or space conduct electricity through electromagnetic radiation.

Explanation:

Energy flow is parallel to wave motion. To pass across, the wave needs a source. Electromagnetic radiation bring energy to the surroundings; they conduct electricity via media and room by mechanical waves. 

Answer:

Energy

Matter

Explanation:

i did the lesson

Which person is collecting data through the participant observation method?
O A. William, who is reviewing the comments people wrote on
questionnaires
B. Dakota, who is calculating the results from a survey
OC. Hosea, who is watching people in their normal suroundings
OD. Brittany, who is reading research done by others

Answers

Answer:

C. Hosea, who is watching people in their normal surroundings.

Explanation:

Which of these characteristics is often used as a measure of an ecosystems health? A. The variety of species that lives there B. The number of people who live there C. The amount of population that occurs there D. The types of activities that can be done there

Answers

Answer:

A

Explanation:

Because the more species that live their can determine how well the environment is doing.And that their is enough resources for them to survive.

have white or brown fur The allele for white furis recessive to the allele for brown for what's
individual with white fur?

Answers

Answer:

When a true-breeding black guinea pig is crossed to a white one, a) What fraction of the F1 offspring is expected to be heterozygous? answer: 100% ... 5) The absence of legs in mice has been attributed to a recessive allele. A normal.

Explanation:

the answer is 100% because the table square with all the gene information it makes sense

Salinization lowers crop yields.
True or false ?

Answers

True Salinization mowers crop yields

The chemical equation for cellular respiration is:

glucose + oxygen ----> your mama

carbon dioxide + water
sunlight --->glucose + oxygen

oxygen + carbon dioxide glucose + water

glucose + oxygen --->carbon dioxide + water + ATP (energy)

Answers

Answer: The last one

Explanation:

Glucose+oxygen----> Carbon dioxide+ water+ ATP(energy)

Harvesting wood from forests is one the top industries in the world. There are various ways for loggers to harvest this wood. Which of the following would provide the best sustainable use of the land?

A. Strip cutting the trees because only mature trees are cut

B. Clear cutting the trees because it is the most cost effective method

C. Clear cutting the trees because it produces the greatest timber yield

D. Strip cutting the trees because it minimizes widespread destruction

Answers

Answer: D. Strip cutting the trees because it minimizes widespread destruction

Explanation: I think it's (d) because when forest fires occur, the trees will catch as well leading to it to travel from tree to tree, eventually getting around the forest, jungle woods, or wherever the fire occurs

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

How are fly eyes and mouse eyes different? Similar?

Answers

Answer:

Fly eyes and mouse eyes look very different and have different structures. However, both types of eyes have the same function. They sense light and make vision possible. ... If the Pax6 gene coded for parts of the actual eye, then the fly would develop mouse eyes in addition to normal fly eyes when the gene was inserted.

Explanation:

Bcz Instead they loke same but if you see the flying eyes and see the mouse eyes the flying eyes conrain fax si that they look different..

Ope it helps

Which cell structures work together to get and use energy?

Answers

Answer:

The Mitochondria

Explanation:

Answer:

The cell wall and the chloroplasts.

Explanation:

The chloroplasts help generate energy in the plant cells.

Nitrogen from animal wastes or plant an animal tissue
O must be fixed near leguminous plants,
O is lost from the system.
O is fixed by bacteria and fungi in the soil.
O is already fixed and can be used.

Answers

System is okay better

Nitrogen from animal wastes or plant an animal tissue  is fixed by bacteria and fungi in the soil.

So, option C is correct one.

How plants and animals get nitrogen ?Since our atmosphere contains 78% of nitrogen but it is very difficult  to take directly by plants and animals.Nitrogen is very essential for all living organism.Plants take nitrogen from soil.Some bacteria and fungi are present in the soil who fix nitrogen from the atmosphere and convert it into nitrogen compound.Then this nitrogen from the soil by root system of the plants.Now plant use this nitrogen for synthesis of proteins and other compounds.Animals who feed plants gets this proteins and other nitrogen compound from plants.When plants and animals die , fungi and bacteria present in the soil converts this nitrogenous waste into nitrogenous compound and reuse of nitrogenous compound is repeated again.

learn about nitrogenous waste,

https://brainly.com/question/9423629

#SPJ2

PLEASE SEE THE IMAGE BELONG I DONT KNOWWWWWW PLEASE

Answers

Answer:

Black

Black

White

Explanation:

the capital letter represents the black fur since it's dominant and the recessive  shows when there are no dominant traits in the mix

Answer:

black black white.

Explanation:

capital letters mean black

coyote
black-footed ferret
hawk
bison
rabbit
prairie dog
blue stem grass
Which argument for protecting the prairie dog best relates to the flow of energy in the ecosystem?
A. Prairie dogs eat grass and other plants that cattle graze on
B. Prairie dogs are an important source of food for many other species.
C Prairie dogs dig in the soil, which improves its quality and helps plants grow.
D. Prairie dogs make burrows which are used as habitat by other important species.

Answers

I think that would be B:  Prairie dogs are an important source of food for many other species.

hope this helps. and please correct me if I'm wrong ^^

plz help i need it i have to turn it in tomorrow

Answers

1.Gravity

2.spheres

3.bigger

4.planets

5.ground

6.interia

7.straight

8.force

9.direction

10.holds

11.balance

GOOD LUCK !

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.

2. Create a complementary
strand of DNA for the
DNA strand show below.
A T C G T G A

Answers

Answer:

T A G C A C T

Explanation:

Adenine (A) and Thymine (T) are base-pairs, alongside Cytosine (C) and Guanine (G). Only A - T or G - C are base-pairs in DNA strands, you will never see Adenine (A) and Cytosine (C) together in a DNA or RNA strand.

If a sample originally had 120 Adams of carbon 14 how many atoms will remain after 17,190 years

Answers

Answer:

15 atoms

Explanation:

About 15 atoms out of the 120 Adams would remain.

Generally, the half-life of a substance is the time it takes for one-half of that substance to disintegrate.

Carbon 14 has a half-life of approximately 5,730 years. 17,190 years means that the sample had stayed for 17,190/5,730 which is equal to 3 carbon-14 half-lives.

Out of 120 Adams,

the first half-life will reduce 120 to 60 Adamsthe second half-life will reduce 60 Adams to 30 Adamsthe third half-life will reduce 30 Adams to 15 Adams.

Hence, at the end of the 17,190 years, approximately 15 Adams would remain.

Which option percent of valid hypothesis in the correct form?
A if a cotton plant receives 100 ml of water ever day it will display steady growth
B if cotton plant need consistent amount of water to grow steadily than the cotton plant that receives 100 mL of water Everyday Will displayed study group
C if a cotton plant needs a constant amount of water to grow steadily than a contact that displays Teddy Grove and you will receive a hundred mL of water every day
D the cotton plant displays steady growth it will receive 100 ml of water every day

Answers

The answer to the question is possibly A

the biotic factors of each land biome are determined by its ___
climate
organisms
location
size

Answers

Climate hope this helped

Answer:

climate

Explanation:

2) Jean is a 12 year old girl who consumed chicken that was not fully cooked at a restaurant.
Thirty-six hours later, she started vomiting and was constantly having diarrhea. After a week,
she had a fever and swelling around her eyes and under her neck.


help me pls

Answers

She has salmonella? What is the question?

Salmonella infection and campylobacteriosis cause diarrhea after eating partially cooked chicken. This causes food poisoning.

What is food poisoning?

An illness called food poisoning is brought on by consuming tainted food. Most people recover without treatment in a few days and it's typically not dangerous. The food is typically contaminated with bacteria, such as salmonella or Escherichia coli (E. coli), or a virus, like a norovirus, in cases of food poisoning.

more than three days of diarrhea. A high fever (102°F or above) vomiting so frequently that it is difficult to swallow liquids. Dehydration symptoms include not peeing as frequently, a dry mouth and throat, and feeling lightheaded while standing up.

Hence, Jean suffered from food poisoning caused by salmonella infection.

Learn more about food poisoning, here:

https://brainly.com/question/16327379

#SPJ2

Is nature or nurture more important

Answers

Answer:

Yes

Explanation:

cus

it keeps us alive

The answer is completely subjective. I’ll assume you are talking about raising children simply because this vocabulary is often used in that case.

Nature can go from describing events out of our control, innate feelings, to describing the area we are raised in. Nature can go a long way with raising kids, in comes the theory’s of the “murder gene.” The aforementioned gene is a theory on the “murderous” behaviors in children sociopaths, or psychopaths. This theory exists because of some unexplainable behaviors the children have that were not taught, like hurting animals and lack of empathy.

In a more lose interpretation of Nature it can mean the area children are raised in. Like the different between a trailer park and a mansion. But generally Nature refers to innate, uncontrollable, behaviors.


On the other hand Nurture refers to the actual raising of the child. Referring back to the “murder gene” the question is if you could reverse the effects of the gene in children based on how you raise them. Nurture is also an argument for how kind you should be to your child as they are growing.

Personally I think Nurture is more important, but in all actuality a good balance is best.

Can someone help me?

Answers

A because it it’s cool

Veronica wrote Charles Darwin’s main points on the board, but she made a mistake in one point.

1. Since more offspring are produced than an environment can support, organisms within a population must compete for resources to survive.

2. Due to variations within the population, some competitors will be better equipped for survival than others.

3. The best-equipped organisms will survive and will produce well-equipped offspring.

4. Variations that help with survival will be passed on to future generations and will rapidly change the whole population.

Which point is flawed as written above?
point 1
point 2
point 3
point 4

Answers

Answer: the answer is 4. Variations that help with survival will be passed on to future generations and will rapidly change the whole population.

Explanation:

Anyone know I’m confused

Answers

Answer:

the correct option is

A. All plant cells have at least one vacuole but only some animal cells have vacuole

Answer: C

Explanation:

All have them, although they vary in size and function

20 points and will mark brainliest! Please explain how you got it though

Answers

Answer:

crossing over during meiosis

Explanation:

i just had biology last semester hope this helps

Other Questions
Match each vocabulary word on the left in Column A with the correct definition on the right in Column B.Column A1.accurate:accurate2.challenge:challenge3.culture:culture4.doodle:doodle5.environment:environment6.invent:invent7.motivate:motivate8.sketchbook:sketchbook9.two-dimensional:two-dimensionalColumn Ba.flat, having only two dimensions, especially length and widthb.call to engage in a contest, fight, or competition c.staying true to fact; errorless d.to scribble without purpose e.social patterns, arts, beliefs, institutions, and other products of human work and thought f.to produce or make (something previously unknown) g.to provide with an incentive or reason; move to action h.conditions that surround you i.a pad of paper used for sketching HELP I NEED ANSWERS ASAPwhat is the rule for ar verbs like habalr to hablo or hablas. stuff like that I need help with this what is the vertical asymptote of f(x)= 7/ x + 5 She can't part.....her jewels. What do the C major, C sharp major and C flat major scales have in common? Need help with this question!A stake is to be driven into the ground 38 feet from the base of a pole, as shown in the diagram below. A wire from the stake on the ground to the top of the pole is to be installed at an angle of elevation of 52. What will be the length of the wire from the stake to the top of the pole, to the nearest hundredth of a foot. What happened after the Bank War?Public confidence in the economy grew.Jackson lost his bid for reelection.Jackson won a third term as president.Inflation weakened the economy.Edit its D If EG = 3y - 10 and ET = 2y, find the value of y In parallelogram FGHI.1Find Value of y. When we compute the mean of a frequency distribution, why do we refer to this as an estimated mean? Find the percent increase from 85 to 125 Do rules of the game promote or prevent opportunism? At the local theatre, 120 people attended at the production of Romeo and Juliet on Friday. The attendance on Saturday was 140% of the attendance on Friday. How many people went to the theatre on Saturday? Many artists of the Song dynasty portrayed the "idea" of objects, leaving blank space in their painting on purpose. This practice was due to influence of which Chinese philosophy? Which refers to the amount of heat required to change the temperature of 1 gram of a substance by 1C and is related to the chemical composition of the substance?Thermal energySpecific heatActivation heatBoiling point30 points Nicole and all of her co-workers wear blue uniforms. Andrew works with Nicole. Olivia does not wear a blue uniform. Everyone who wears a blue uniform also wears a white shirt . Which statement must be true?A. Olivia wears a white shirtB. Olivia does not work with NicoleC. Some of Nicole's co-workers do not wear white shirtsD. Olivia is a co-worker of Nicole E. Nicole does not wear a white shirt Need Help ASAP. Use the graph to answer the following questions. (NOTE: LOOK AT THE KEY!!!)How many years does it take a cardboard box to decay?A.) 8B.) 4C.) 20D.) 25 Can someone help me find the complete square please? What is 514 times 33? Please help asap!!! math math math math math math help