Even though individuals only have two alleles for any given gene, there may be many different alleles for that gene within the human population. What is the term for this phenomenon?
Group of answer choices
Multiple alleles
Genetic diversity
De novo mutation
Allelic variety
Answer:
Genetic diversity
Explanation:
Genetic diversity is when a population of a species, humans, in this case, have different genes between different individuals. One person may have blue eyes while the others have brown. This shows diversity within the gene pool.
Genetic diversity is also important to the survival of a species. Two-parent reproduction leads to genetic diversity. Having different alleles within a population allows for adaptation. On the other hand, one-parent reproduction does not allow for genetic diversity. This hinders the species because it does not let species to slowly improve the gene pool through natural selection and adaptation.
how was earth created ?
Answer:
Formation.
Explanation:
Earth formed when gravity pulled swirling gas and dust in to become the third planet from the Sun.
4. What is the carrying capacity of Wildebeest in the Serengeti?
Answer:
1,300,000
Explanation:
Explain that this limit is called the carrying capacity, and that it is the largest population size that the environment can support in the long run.
explain the difference between microevolution and macroevolution
How might evidence obtained from genetic counselors change the lives of families?
Answer:
Genetic counseling can help you proactively identify genetic risk factors, based on an expert review of your personal and family health histories.
Explanation:
A genetic counselor can help you get appropriate genetic testing and address risks through personalized medical recommendations for you and your doctor to put into action.
What substance is produced during photosynthesis that is also a reactant for cellular respiration
Answer:
Photosynthesis converts carbon dioxide and water into oxygen and glucose
Explanation:
During the cell cycle,chromatin will undergo changes in packing . State the two forms of chromatin and relate its structure to the process of DNA replication.
Chromatin exists in two forms. One form, called euchromatin, is less condensed and can be transcribed. The second form, called heterochromatin, is highly condensed and is typically not transcribed. Under the microscope in its extended form, chromatin looks like beads on a string.
Pa brainliest po
Can someone please help me with this I’ll give u brain list !!
Answer:
Here u go ;)
Explanation:
Livestock :- animals that are kept for the goods they offer and that can be sold for profit
Overharvesting :- catching or removing from a population more organisms than the population can replace
Aquaculture :- involves raising aquatic organisms for human use
Drought :- lack of water in an area causing crops to die
Famine :- the social and economic crisis in a given area that is commonly characterized by widespread malnutrition, starvation, etc.
Malnutrition :- when an organism does not consume enough nutrients needed to fulfill the body's needs
Diet :- The type and amount of food a person eats
Pesticides :- Chemicals that protect crops from harmful plants and insects
Carbohydrates :- Primary source of energy for the body
Erosion :- the wearing away of soil by wind and water
What does the term “evolution” mean to you
Answer:
In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.
Explanation:
Answer:
evolution means the making of judgement about the amount number or value of something
The ileum has an acidic environment due to the presence of hydrochloric acid.
true or false
Answer:
true
Explanation:
How does deforestation increase the warming of earth
Answer:
Explanation:
Forests and trees store carbon . When they are degraded or completely cleared, e.g. by fire – a process referred to as deforestation – this stored carbon has the potential to be released back into the atmosphere as carbon dioxide and contribute to climate change .
6. In the food chain shown, which animals are prey? (Select all that apply.)
grass
grasshopper
frog
snake
eagle
Answer:
Grasshopper and frog.
Explanation:
Hope this helps.
Answer:frog, snake, eagle
Explanation:
i need an explanation for this myth i have made for my science assignment "why are fish and plants not in the same phylum"
Answer:
They can't be in the same phylum because they are in two different categories on the basis of Mode of nutrition. Plants are autotrophs, while animals are heterotrophs. Cell wall is present in plant cells, while it is absent in animal cells.
Explanation:
A phylum is a major group of animals or in some classifications plants sharing one or more fundamental characteristics that set them apart from all other animals and plants/
Do buffaloes overgraze?
Answer:
No
Explanation:
I don't believe Buffaloes overgraze.
identify the main function of a stereo dissection microscope
Answer: Allows a magnified 3-Dimensional perspective when dissecting. This enables more accuracy in movements.
Explanation:
What is true about the structure or function of the plasma membrane?
A.It is made entirely of integral proteins.
B.The processes of endocytosis and exocytosis occur here.
C.Hydrophilic molecules attract the water the cell requires.
D,The double layer prevents anything from entering the cell
Helppp!!!
Answer: B.
Explanation: Cytosis in this context is the taking in, and releasing of various nutrients, proteins, toxins, etc. in and out of the cell. This is facilitated by the plasma membrane because it's our wall that surrounds the cell deciding who goes in and who goes out.
Sometimes even the most careful food preparation can lead to tragedy. For many generations, humans have made sausages, but on occasion the sausages have become contaminated with Clostridium botulinum, and individuals have developed a deadly disease known as botulism (botulus = “sausage”). How do you think sausage becomes contaminated, and what characteristics of C. botulinum make it attracted to sausage?
Explanation:
I think the sausage is a popular host for this bacteria because most sausages are smoked and that process is a lengthy one.
during the smoking process, the raw meat can sit , in a smoker for hours,sometimes days.
while meat is still in an uncooked state, this opens the door for bacteria to grow; Due to humidity, moisture, no oxygen, & acidity (when salted), this reduces contamination in the food product..
Most producers of sausage cure the meat with
Construct a model to show the movement of matter and energy from plants into other organisms. Show how mass and energy are conserved before and after each interaction. For example, the beginning substances before an interaction equal the ending substances, and vice versa.
I listed a student example I need something like the example but for photosynthesis asap I will give 100 points to whoever has the correct answer
Answer:
you are a copyer
Explanation:
Energy and matter neither created nor destroyed but conserved.
What is matter? "Matter is any substance that has mass and takes up space by having volume."There are three states of matter- solid, liquid and gas.The energy and matter present at the start of any reaction will be same at the end of it as they can neither be created nor destroyed but can change from one form to another.
This can be show by the following diagram-
To know about conservation of mass here
https://brainly.com/question/13383562
#SPJ2
7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?
BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'
5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5
Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.
What are restriction sites?Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.
Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.
Examples of restriction enzymes are Bam1 and EcoR1.
For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'
Two bands will be produced using Bam1 as shown below:
5'ACGAATTCAGTATTATCCTAGG 3'
3'TGCTTAAGTCATAATAGGATCC 5'
5'TATCCGCCGCCGAATTCTCATCA 3'
3'ATAGGCGGCGGCTTAAGAGTAGT 5'
For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'
Three bands will be produced using with EcoR1 as shown below:
5'ACGAATTC 3'
3'TGCTTAAG 5'
5'AGTATTATCCTAGGTATCCGCCGCC 3'
3'TCATAATAGGATCCATAGGCGGCGG 5'
5'TCATCA 3'
3'AGTAGT 5'
Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.
Learn more about restriction sites at: https://brainly.com/question/8886948
Input of energy in most communities comes from the
sun
A. phytoplankton of the oceans
B.
C. tropical rainforest
D. agricultural productivity
Answer:
A: phytoplankton of the ocean
What are the 4 components of natural selection?
What is the nucleold?
An irregularly shaped region within the prokaryotic cell that contains all or most of the genetic material.
The 16s rRNA gene encodes an RNA that would be used as a component of the _________ during ____________.
a. RNA polymerase, transription
b. a protein, DNA replication
c. the ribosome, translation
d. tRNA, DNA replication
The 16s rRNA gene encodes an RNA that would be used as a component of the ribosome during translation (Option c). It is a ribosomal RNA.
What are ribosomal RNAs?Ribosomal RNAs (rRNAs) represent fundamental components of the ribosomes, the protein factories of the cell.
Ribosomes play central roles during the process of translation by which an mRNA is used as a template to produce a polypeptide.
The 16S rRNA is a constituent of the bacterial small ribosomal subunit, which is used during translation.
Learn more about ribosomal RNAs here:
https://brainly.com/question/930760
which statement BEST describes the reason for the change in the cell membrane model?
The new model was the result of a vote by scientists.
The new model help scientist avoid more research.
The new model came from more experiments and evidence.
The new model is based on the researchers best guess.
Answer:
The new model came from more experiments and evidence.
Explanation:
As more research and better technology came out scientists were able to update to a more accurate model.
What evidence is there that the bat and dolphin share a common ancestor? Explain how the two species could be so different.
Answer:
I hope the below helps!
Explanation:
Scientists have noticed similarities between a bat's wings and a dolphin's flippers.
Fossil records also show that the 2 animals have the same/similar skeletal elements. These skeletal elements have evolved into different shapes and sizes based on their function. For example, the flipper of a dolphin is adapted for swimming and the wing of a bat is adapted for flying.
This evidence shows that the 2 species are distantly related and share a common ancestor.
Which of the following can be the product of an expressed gene?
• DNA
• Protein
• Chromosome
• Part of a Protein
• a switch telling other genes when to expresses or not
TEXT REFERENCE HERE ➪
Answer:
part of a protein
Explanation:
part of a protein
Compare and contrast each of the following pairs of terms: (a) circulatory system and cardiovascular system, (b) complete blood count and complete blood count with differential.
The circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.
What is circulatory system and cardiovascular system?The cardiovascular system covers those structures (heart and blood vessels) that allow blood and lymphatic circulation (circulatory system).
What is a complete blood count?It is a scheme that allows to represent the composition of the blood.
What is a complete blood count with differential?It is one of the tests that allows counting each of the leukocyte types.
Differences between circulatory system and cardiovascular system, complete blood count and complete blood count with differentialCirculatory system and cardiovascular system are linked to the set of organs and structures that allow blood and lymph to travel through the body.A complete blood count examines the types and numbers of cells in the blood: white blood cells, red blood cells and platelets by performing a blood count of these main cells.A complete blood count with differential is used to diagnose and monitor many different conditions, including anemia measuring the percentages of each type of white blood cell.Therefore, we can conclude that the circulatory and cardiovascular system are responsible for bringing nutrients and oxygen to all the cells, therefore, a complete blood count quantifies and evaluates different types of blood cells, while a complete blood count with differential consists in recognizing and assessing the proportions of the different varieties of leukocytes.
Learn more about circulatory and cardiovascular system here: https://brainly.com/question/1023001
• Seasonal movement to a different geographical region where
conditions are more favorable
Answer:
Maybe a more warm location???
Explanation:
What term represents the six anatomical locations of predictable movement patterns where movement dysfunctions can be detected
Kinetic chain checkpoints represents the six anatomical locations of predictable movement patterns.
What is Kinetic chain checkpoints?This is referred to interrelated groups of body segments, connecting joints, and muscles which are connected to a portion of the spine in the human body.
They work together to ensure body parts are easily moved and movement dysfunctions can be detected through them.
Read more about Kinetic chain checkpoints here https://brainly.com/question/789840
can you make an example sentence of a physical change?
Answer:
when water turns into ice.
Explanation:
it changes the physical phases of matter.
Answer:
Lila put some ice cubes in a tray and left them out on the kitchen counter for thirty minutes. When she came back the ice was melted, so she had to put them back in the freezer to refreeze.
Explanation:
A physical change is a generally reversible change. Eg. Ice melting, dissolving sugar and water, and boiling water are all examples of physical change!
Hope this helps :)
