What was one idea that the leaders of the American Revolution shared with
Enlightenment thinkers?

Answers

Answer 1

Answer:

One idea that was shared was;

Explanation:

"That people have a right to overthrow their government if it exploit it people and mishandle it's power. Also that the government should stay out of economic and to allow free play of natural economic system.


Related Questions

What is an example that could be included in an argumentative essay on Louisiana’s economy?

Louisiana’s state government has been dominated by the Republican Party in the last several election cycles.
Four years ago, my father’s restaurant was struggling to make ends meet, but today it is a profitable business.
One indication of recent economic growth is the steady increase in employment among businesses in the private sector.
Last summer, I noticed a new bakery, movie theater, and gym in my community, which suggested that local business was thriving.

Answers

Answer:

One indication of recent economic growth is the steady increase in employment among businesses in the private sector.

Explanation:

Answer:

C!!

Explanation:

"One indication of recent economic growth is the steady increase in employment among businesses in the private sector."

B and D are anecdotes, and A has nothing to do with the economy at all.

Hope this helps!!

- abakugosimp <3

Where did pre-Colombian Native Americans live?

Answers

Answer:they evolved in mésoaméricaines

Explanation:

To what extent was life in early america similar to and/or different from Europe

Answers

the industrialization was different...Europe was further advanced in industry than America was.

Second Intifada
3. Hamas was organized in
O social, political, military
O social, economic, educational
O domestic, international, military
O military, electoral, international

Answers

Answer:

C

Explanation:

I did it on USA test prep

Answer: a

Explanation:

Was the monroe doctrine successful in keeping the U.S out of European affairs?

Answers

Answer:

The Monroe Doctrine was successful in keeping the United states out of European affairs because after it was issued there was a decrease in foreign conflict for nearly 100 years until WWI.

Explanation:

Answer:

yes

Explanation:

he was

What did the Ancient Greeks do
when they didn't understand
something?

Answers

Answer: Mythology in response to many unknowns.

Explanation:

Ancient peoples developed a huge array of different deities. The Greeks were no exception. The fact is that science was underdeveloped in that period; technology in its current form was thousands of years away. Therefore, the Greeks attributed many phenomena that they could not explain to the deities. So they invented a huge number of gods and myths to “answer” many doubts.

Describe what Manifest Destiny is and how it affected immigration to
Texas, desire to annex Texas to the U.S., and importance to trade and
economy.

PLSS HELP ME!!

Answers

Manifest destiny was the idea that the United States would stretch from sea to sea as a beacon of liberty. Texas had lots of American immigrants at the time and had a lot of slave plantations that could of extended the south. Texas also had recently broken free from Mexico, and was made by American settlers who made their government based on the US. So, because of all this, America decided to annex Texas and incorporate it into the Union.

All of the following are reasons for Georgia to stay loyal to England 1 point
EXCEPT
Georgia had a much smaller population than the other colonies, and it did
not have enough men for an army to fight the British

Georgia was not as successful as the other colonies, and it could not afford
to raise funds to fight the British
Georgia was far younger as a colony than the other colonies, and it still
needed much support from Great Britain
Georgia had more British settlers than the other colonies and they were
more loyal to Great Britain

Answers

Answer:

d

Explanation:

new york had more people than georgia who were loyalists

here, take it and run for the hills, bobby run away before the administers catch you with the points

Answers

Answer:

lol tysmm

Explanation:

ughh im not sure

Answer:

ok dad (I'm straight just had to do it)

Explanation:

lol

Help pls! Question #2. The scientific revolution was most embraced by what in Europe?

Answers

Answer:

Commoners

I'm not sure, but this is what I can remember

The terms of the Proclamation of 1763 convinced many American Indians that supporting the British was in their best interests during the American Revolution. What was a term of the proclamation that the American Indians hoped the British would enforce?

A
Colonists were forbidden from leaving colonial borders without an express invitation from
American Indian leaders.
B
Colonists were forbidden from settling land west of the Appalachians to prevent conflicts with
American Indians.
C
Colonists were required to expand trade with American Indians in an effort to improve the
health of their communities.
D
Colonists were required to transfer ownership of land east of the Appalachians to the original
American Indian owners.

Answers

Answer:

B. Colonists were forbidden from settling land west of the Appalachians to prevent conflicts with

American Indians.

Explanation:

The term of the proclamation that the American Indians hoped the British would enforce is "Colonists were forbidden from settling land west of the Appalachians to prevent conflicts with American Indians."

This is evident in the fact that the Proclamation Act of 1763 stated among other things that "And whereas it is just and reasonable and essential to our interest and the security of our colonies that the several nations or tribes of Indians with whom we are connected, and who live under our protection, should not be mólested or disturbed in the possession of such parts of our dominions and territories as, not having been ceded to or purchased by us, are reserved to them, or any of them, as their hunting grounds; we do, therefore…declare it to be our royal will and pleasure that no governor or commander in chief, in any of our colonies of Quebec, East Florida, or West Florida, do presume, upon any pretense whatever, to grant Warrants of survey or pass any Patents for Lands beyond the bounds of their respective governments..."

Review map of Asia which number on the map shows the approximate location of the end of the aryon migration

Answers

Answer:

india

Explanation:

Help with this question pls I'll give brainliest!
If you have watched the movie 1917 this this question pls

Answers

Answer: Lance Corporal Schofield (George MacKay) are called into their superior’s bunker. The troops at the front line are about to walk into an ambush, they’re told by a fictional General Erinmore (Colin Firth). They plan to go on the offensive and attack the German forces, who appear to be retreating, but it’s a trap. 1,600 lives are at risk and the only way to get news to the operation’s commanding officer is for Blake and Schofield to hand-deliver a letter. They must exit the trenches, cross No-Man’s Land, get through the German encampments and then also a town, and then head down river to the woods where the men are preparing for what they don’t know is a certain slaughter.

how could have George Washington presidency served as a valuable example for other presidents to follow?

Answers

Not only was Washington the first to take the office but he was also seen as a respected almost idolized figure so it was up to him to layout the footwork of how the office would be held.

Which statement about the following excerpt from the first paragraph would the author be most likely to agree with? "The camera panned over crisply efficient workers on an assembly line where the boots were being produced by the thousands. The narrator raved about the superb quality of the boots and reeled off the impressive production statistics."

Answers

Answer

The program has likely been carefully edited and scripted to show off the shoe factory in the best possible way.

Explanation:

Do the ratios 14:12 and 7:6 form a proportion? YES OR NO?

Answers

Answer:

yes

Explanation:

Sandra is heterozygous for eye shape. help!!!!

What does this mean?

She has two of the same alleles for eye shape, one from each parent.
She has two different alleles for eye shape, one from each parent.
She has only one allele for eye shape, which she received from one parent.
She has two alleles for eye shape, both from the same parent.

Answers

Answer:

b

Explanation:

i took the test

Answer:

B. She has two different allele for eye shape, one from each parent

Explanation:

Im taking th test rn lol

The Battle of Fallen Timbers of 1794 was an example of an attack
by European troops on American Indians.
by American settlers on American Indians.
by American Indians on American settlers.
by American Indians on American soldiers.

Answers

Answer: d. by american indians on american soldiers

Explanation: just took the test :)

Answer:

answer is d

Explanation:

edge 2021

HELP NOWW HELP NOWW
The 2000s have been a, "free-wheeling age of fast growth, uneven gains and prosperity, and corporate
heroes/villains” just like the 1880s - 1910s during the 20 Industrial Revolution. Agree/Disagree. Explain
your answer

Answers

Answer:

Disagree

Explanation:

The 2000s had many economic down pluders such as 9/11 and a stock market crash. In contrast, the industrial revolution led to mechanized manufacturing, and the factory system. New machines, new power sources, and new ways of organizing work made existing industries more productive and efficient.

Hope this helps! If you'd like to check my facts, I can send you the links I used to make sure the context is correct.

How did the fighting in the west differ from the fighting in the south

Answers

Answer:

The ohana river

Explanation:

The west differ is a much different place from south. The ohana river is safer to transfer from.

What is the only Court mentioned in the constitution

Answers

Answer:

Supreme Court

Explanation:

The Supreme Court is the only federal court that is explicitly established by the Constitution. During the Constitutional Convention, a proposal was made for the Supreme Court to be the only federal court, having both original jurisdiction and appellate jurisdiction.

Answer:

The Supreme Court is the only federal court that is explicitly established by the Constitution. During the Constitutional Convention, a proposal was made for the Supreme Court to be the only federal court, having both original jurisdiction and appellate jurisdiction.

Explanation:

what does Long propose people do once they become millionaires?
A) Share the wealth with others.
B) donate money to charitable causes.
C) help others open bank accounts.
D) deposit their money into banks.

Answers

Answer:

a

Explanation:

To share our wealth by providing for every deserving family to have one third of the average wealth would mean that, at the worst, such a family could have a fairly comfortable home, an automobile, and a radio, with other reasonable home conveniences, and a place to educate their children.

the helping hand of jackle

Answer:

A doing the assignment rn! goodluck on 3rd quarter!

Explanation:

Which of the following applies to political parties? * 1
(1 Point)
began during George Washington's time
began during Abraham Lincoln's time
began during the 20th Century
are required by the Constitution

Answers

Answer:

Political parties began during George Washing's time as president.

Explanation:

Polical parties or fractions began to form during the struggle of the federal Constitution of 1787 but wasn't required by the Consitution.

How many people died in the 30 year period between WWI and WWII? O 100,000,000 O 50,000,000 O 10.000.000 0 20.000.000 O none of the above​

Answers

Answer:

50,000,000

Explanation:

What was the wonderful 15th Amendment that would be proposed by the Radical Republicans that followed the 14th Amendment that made former slaves American citizens and prevented most Confederate leaders from holding political offices?

Answers

Answer:

The 15th Amendment of the United States was to allow all of its citizens, no matter their race, beliefs, or color to vote.

This followed the 14th Amendment because it freed the slaves and allowed them to become American Citizens. The 15th Amendment worked almost like a reminder to show that the slaves were free by saying they could vote as citizens.

Making false statements that are not true, during the COLD WAR
A. Yellow lourmalis
B. Prapagana
C. McCaryism
D. Fale News

Answers

Answer:

B

Explanation:

Propaganda means misleading so b

D I no it so when you got it rite I’m going to say I tails you so

Please provide a brief overview of what happened to the following individuals during the Civil Rights movement. - Name, Date, Role, Etc. - If possible, please include a picture of the individual(s). May 7, 1955 The Rev. George Lee killed for leading voter-registration drive, Belzoni, Miss. August 13, 1955 Lamar Smith Murdered for organizing black voters, Brookhaven, Miss. August 28, 1955 Emmett Louis Till Murdered for speaking to a white woman, Money, Miss. October 22, 1955 John Earl Reese Slain by Nightriders opposed to school improvements, Mayflower, Texas January 23, 1957 Willie Edwards Jr. Killed by Klansmen, Montgomery, Ala. April 25, 1959 Mack Charles Parker Taken from jail and lynched, Poplarville, Miss. September 25, 1961 Herbert Lee Voter registration worker, killed by white legislator, Liberty, Miss. April 9, 1962 Cpl. Roman Ducksworth Jr. Taken from bus and killed by police, Taylorsville, Miss. September 30, 1962 Paul Guihard European reporter killed during Ole Miss riot, Oxford, Miss. April 23, 1963 William Lewis Moore Slain during one-man march against segregation, Attalla, Ala. June 12, 1963 Medgar Evers Civil rights leader assassinated, Jackson, Miss. September 15, 1963 Addie Mae Collins, Denise McNair, Carole Robertson & Cynthia Wesley Schoolgirls killed in bombing of Sixteenth Street Baptist Church, Birmingham, Ala. September 15, 1963 Virgil Lamar Ware Youth killed during racist violence, Birmingham, Ala. January 31, 1964 Louis Allen Witness to murder of civil rights worker, assassinated, Liberty, Miss. April 7, 1964 Rev. Bruce Klunder Killed protesting construction of segregated school, Cleveland, Ohio May 2, 1964 Henry Hezekiah Dee & Charles Eddie Moore Killed by Klansmen, Meadville, Miss. June 21, 1964 James Chaney, Andrew Goodman & Michael Schwerner Civil rights workers abducted and slain by Klansmen, Philadelphia, Miss. July 11, 1964 Lt. Col. Lemuel Penn Killed by Klansmen while driving north, Colbert, Ga. February 26, 1965 Jimmie Lee Jackson Civil rights marcher killed by state trooper, M

Answers

Answer:

mooooooooooooooooooooooooooooooooooooooooooooooooppppppppooooooooooooooooooooooooooseeeeeeeeeee2wweeeeeeeeeeeee

What were the major conflicts of the revolution

Answers

Battle of Lexington and Concord. Battle of Lexington by François Godefroy 1775. ...
Siege of Boston. Henry Knox bringing cannons from Fort Ticonderoga down to Boston 1776. ...
Declaration of Independence. ...
Battle of Ticonderoga. ...
Battle of Bunker Hill. ...
Battle of Quebec. ...
Battle of Long Island. ...
Great Fire of New York.

now now, there is no time to waste as there shall be a new legend born before the new star.

when they said new star, what do they refer to?

Answers

Explanation:

God put the star there for the wiseman

Answer: New star referes to the legend.

Explanation: An explanation for this question is not needed as the question uses common sense. Hope this helps and you have a nice fun day, its friday! :)

How were the American colonists able to finally transition from a monarchy to a democracy?
a. the king of England conceded before the dispute for control lead to war
b. the Boston Tea Party
c. the Revolutionary War
d.George Washington was able to negotiate a treaty with King George III

Answers

Answer:

C. the Revolutionary War

Explanation:

The American colonists transitioned from a British monarchy to a democracy after they won their independence from the Revolutionary War.

Once they won their independence, they established their own government independent from the British.

This was a democratic government outlined by the US Constitution.

So, the correct answer is C.

Other Questions
Tiana deposited $500 into an account that earns 6% simple interest. How many years will it take for the value of the account to reach $2,000? (HELP PLEASE) As part of the science experiment a student observes the growth of a population of bacteria and four different media the table below that stops or visions the student made in which media can the change in the population of bacteria be modeled by a linear function. someone help please... find the commission.earning CommissionSales Commision Rate Commission$6807%?The commission is $ in thank you ma'am when ms jones and roger arrive at ms jones house what does roger do ? I need help to find the Area HELP I WILL mark brainliest Help please due at 9:40 When making a book cover, Anwar adds an additional 20 square inches to the surface area to allow for overlap. How many square inches of paper will Anwar use to make a book cover for a book 11 inches long, 8 inches wide, and 1 inch high? Biologists studying horseshoe crabs want to estimate the percent of crabs in a certain area that are longer than 35 centimeters. The biologists will select a random sample of crabs to measure.Which of the following is the most appropriate method to use for such an estimate?A. A one-sample z-interval for a population proportionB. A one-sample z-interval for a sample proportionC. A two-sample z-interval for a population proportionD. A two-sample z-interval for a difference between population proportionsE. A two-sample z-interval for a difference between sample proportions Use the following data to answer the questions that follow:Cameroon TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAATTsavoTTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAATCGCCTCCTCAAATFannie Roberts TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATSabi Sands TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTGAAATUmfolozi TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATZimbabwe TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATZambiaTTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATKalahari TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAATBotswana TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAATEtoshaTTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT5) What question can the data above help to answer? Write your question here: Which one of the following is a truestatement?Percentage earned at the end of this courseis a one-to-one function of SFU studentnumber.SFU student number is a one-to-one functionof percentage earned at the end of thiscourse.Percentage earned at the end of this courseis a function of SFU student number, but it isnot one-to-one.SFU student number is a function ofpercentage earned at the end of this course,but it is not one-to-one. 493 times 5 minus 76Also if any of you watch impractical jokers who is your favorite Which of the four civilizations emerged first? Whats the answer someone help ? What effect did the Industrial Revolution have on where people lived in Europe and America?A) It motivated people to move to cities in order to work in factories, rather than remain on family farms.B) It had almost no effect on where people lived in Europe, since factories were everywhere.C) It caused many people to move to other countries in search of higher-paying factory jobs. A man travels 9 units to the right and then 11 units to the left find the displacement and distance travelled I need help what is: intercepts from a equation3x+2y=5 PLSSS HURRY, IM GIVNG WHOEVER GIVES THE CORRECT ANSWER FIRST BRAINIEST!!! Read the excerpt from Immigrant Kids by Russell Freedman.Immigrants usually crossed the Atlantic as steerage passengers. Reached by steep, slippery stairways, the steerage lay deep down in the hold of the ship. It was occupied by passengers paying the lowest fare.Men, women, and children were packed into dark, foul-smelling compartments. They slept in narrow punks stacked three high. They had no showers, no lounges, and no dining rooms. Food served from huge kettles was dished into dinner pails provided by the steamship company. Because steerage conditions were crowded and uncomfortable, passengers spent as much time as possible up on deck.The voyage was an ordeal, but it was worth it. They were on their way to America.Which is an example of paraphrasing the excerpt?1. Because steerage conditions were crowded and uncomfortable, passengers spent as much time as possible up on deck.2. Freedman writes that the long trip was an ordeal, but it was worth it. They were on their way to America.3. The travel conditions on immigrant ships were very poor. People had no room to sleep comfortably, the food was not good, and there was no way to keep clean.4. One author describes the immigrant voyage this way: the steerage lay deep down in the hold of the ship. It was occupied by passengers paying the lowest fare.HURRY PLSSSS 20 POINTS WILLGIVE BRANILESTThere is one more correct answerIf you don't know the language, DO NOT ANSWERPlease try...