Answer:
In the cytoplasm in different cell types
Answer:
The sugar produced by photosynthesis can be converted into the sugar glucose. Thousands of glucose molecules can be linked together to form the complex carbohydrate starch. Starch is stored inside plant cells as grains.
please help me with questing 16
Answer:
It's either C. or D. I think I'm more leaning toward all of the above.
Explanation:
Adaptation is when organisms change to adapt to the environment.
For example, a white moth could turn black to blend in with certain tree barks, shadows, dirt, etc. Hope this helped!
Harvesting wood from forests is one the top industries in the world. There are various ways for loggers to harvest this wood. Which of the following would provide the best sustainable use of the land?
A. Strip cutting the trees because only mature trees are cut
B. Clear cutting the trees because it is the most cost effective method
C. Clear cutting the trees because it produces the greatest timber yield
D. Strip cutting the trees because it minimizes widespread destruction
Answer: D. Strip cutting the trees because it minimizes widespread destruction
Explanation: I think it's (d) because when forest fires occur, the trees will catch as well leading to it to travel from tree to tree, eventually getting around the forest, jungle woods, or wherever the fire occurs
How do adaptations lead to change?
An organism has a haploid number of 20. What is the organism's diploid
number?
answer 18 and 19 Please help I will mark brainliest
Answer:
18. J.
19. B 23 chromosomes
Answer:
23
Explanation:
answer 18 and 19 Please help I will mark brainliest
Where do the mineral resources in which society depends on come from
Answer:Without minerals we would not have electricity, food, or shelter. Minerals make today's technology-based life possible, but that's something many of us take for granted.
Explanation:Soil, rocks, and minerals provide essential metals and other materials for agriculture, manufacturing, and building. 7.7. Earth scientists and engineers develop new technologies to extract resources while reducing the pollution, waste, and ecosystem degradation caused by extraction.
Help me with this I’ll give 50points !!
Answer:
straightLustre,shinemirror Transparent,propertynot at depth,faster 7.oblique,blocksHope it helps
If a sample originally had 120 Adams of carbon 14 how many atoms will remain after 17,190 years
Answer:
15 atoms
Explanation:
About 15 atoms out of the 120 Adams would remain.
Generally, the half-life of a substance is the time it takes for one-half of that substance to disintegrate.
Carbon 14 has a half-life of approximately 5,730 years. 17,190 years means that the sample had stayed for 17,190/5,730 which is equal to 3 carbon-14 half-lives.
Out of 120 Adams,
the first half-life will reduce 120 to 60 Adamsthe second half-life will reduce 60 Adams to 30 Adamsthe third half-life will reduce 30 Adams to 15 Adams.Hence, at the end of the 17,190 years, approximately 15 Adams would remain.
The author mentions that Shine made several mistakes in her experiment. Describe one major mistake that Shine made.
Answer:
theres no expirement attached, attach an expirement and i can answer
Explanation:
Can someone please helpppppo I’ll mark the brainliest
Answer:
C [the third one btw]
Explanation:
He believed that evolution gradually [slowly] happened over time.
Hope this helps :D Have a great day
The chemical equation for cellular respiration is:
glucose + oxygen ----> your mama
carbon dioxide + water
sunlight --->glucose + oxygen
oxygen + carbon dioxide glucose + water
glucose + oxygen --->carbon dioxide + water + ATP (energy)
Answer: The last one
Explanation:
Glucose+oxygen----> Carbon dioxide+ water+ ATP(energy)
MULTIPLE CHOICE QUESTION
Are a majority of the problems associated with down syndrome a result
of an over or under expression of chromosome 21?
under
over
A truck was carrying a substance in a tank. The molecules of that substance were moving away from each other. The truck parked overnight in a place where energy transferred out of the substance. In the morning, the substance was a gas. How were the molecules moving in the morning?
Answer:
The gases will be together since they do not possess kinetic energy
Explanation:
let us use the kinetic theory of matter to explain the condition of the gas in the morning.
During the day, the atmosphere can be very hot so the gases tend to be in constant random motion, hence they will move away from themselves because they possess kinetic energy.
In the morning the temperature of the atmosphere is relatively low and the vehicle is not in motion, hence the gases will move together because they no longer possess kinetic energy anymore
Poly" means many and "saccharide" means sugar.
Why is polysaccharide a good name for the picture on the right above
!
The process by which modern organisms have descended from ancient organisms
Answer:
evolution, or change over time
Explanation:
Which cell structures work together to get and use energy?
Answer:
The Mitochondria
Explanation:
Answer:
The cell wall and the chloroplasts.
Explanation:
The chloroplasts help generate energy in the plant cells.
Which option percent of valid hypothesis in the correct form?
A if a cotton plant receives 100 ml of water ever day it will display steady growth
B if cotton plant need consistent amount of water to grow steadily than the cotton plant that receives 100 mL of water Everyday Will displayed study group
C if a cotton plant needs a constant amount of water to grow steadily than a contact that displays Teddy Grove and you will receive a hundred mL of water every day
D the cotton plant displays steady growth it will receive 100 ml of water every day
Nitrogen from animal wastes or plant an animal tissue
O must be fixed near leguminous plants,
O is lost from the system.
O is fixed by bacteria and fungi in the soil.
O is already fixed and can be used.
Nitrogen from animal wastes or plant an animal tissue is fixed by bacteria and fungi in the soil.
So, option C is correct one.
How plants and animals get nitrogen ?Since our atmosphere contains 78% of nitrogen but it is very difficult to take directly by plants and animals.Nitrogen is very essential for all living organism.Plants take nitrogen from soil.Some bacteria and fungi are present in the soil who fix nitrogen from the atmosphere and convert it into nitrogen compound.Then this nitrogen from the soil by root system of the plants.Now plant use this nitrogen for synthesis of proteins and other compounds.Animals who feed plants gets this proteins and other nitrogen compound from plants.When plants and animals die , fungi and bacteria present in the soil converts this nitrogenous waste into nitrogenous compound and reuse of nitrogenous compound is repeated again.learn about nitrogenous waste,
https://brainly.com/question/9423629
#SPJ2
Anyone know I’m confused
Answer:
the correct option is
A. All plant cells have at least one vacuole but only some animal cells have vacuole
Answer: C
Explanation:
All have them, although they vary in size and function
It is advantageous for a predator to prey exclusively on a single prey species.
Answer:
Assuming this is a true/false question, the answer would be false.
If a predator only preyed on one species, it would be at a disadvantage if the prey it feeds on gets wiped out in that region.
Therefore, your answer is False.
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
Crossing-over occurs
a. during prophase 2.
c. during prophase I.
b. during fertilization.
d. at the centromere
plz help i need it i have to turn it in tomorrow
1.Gravity
2.spheres
3.bigger
4.planets
5.ground
6.interia
7.straight
8.force
9.direction
10.holds
11.balance
GOOD LUCK !
Turner syndrome occurs in females who instead of having two X chromosomes have either only one X chromosome or a fragmented X chromosome. Klinefelter syndrome occurs in males who have multiple X chromosomes. Consider the karyotype.
A karyotype indicates that a male has multiple x chromosomes.
Which individual is shown in the karyotype?
male with Turner syndrome
male with Klinefelter syndrome
female with Turner syndrome
female with Klinefelter syndrome
Answer:
male with Klinefelter syndrome
Explanation:
for an individual to be considered male he needs to have at least one Y chromosome
usually an individual with Klinefelter syndrome has two X chromosomes instead of 1 and 1 Y chromosome(XXY) but the karyotype can also be XXXY
Answer:
its B
Explanation:
it belongs to a man with Klinefelter syndrome
PLEASE HURRY!!!! PLEASE!!!!!!!!!What is different about the way people get energy as opposed to plants?
A. People get their energy from food, whereas, plants convert energy from the sun through a process know as photosynthesis.
B. People get energy from jumping around.
C. Plants and people get energy through the same means.
D. Plants eat zombies to get their energy, whereas, people eat pizza.
o
1. Which criteria are used to classify amphibians into orders?
Answer:
They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.
Below are two sequences of a segment of DNA.
Normal sequence TTA AAA GGA
Mutated sequence CTT AAA AGG A
Which type of mutation has occurred?
Arrange the levels of ecological organizations from smallest to largest
population
organism
community
ecosystem
which of the following substances is formed during photosynthsis hurry please thx
Answer:
Glucose
Explanation:
During photosynthesis plants produce a substance called glucose from simple inorganic molecules.
Hope this helps :D Have a fantastic day ^-^
have white or brown fur The allele for white furis recessive to the allele for brown for what's
individual with white fur?
Answer:
When a true-breeding black guinea pig is crossed to a white one, a) What fraction of the F1 offspring is expected to be heterozygous? answer: 100% ... 5) The absence of legs in mice has been attributed to a recessive allele. A normal.
Explanation:
