Which best describes Henry Clay's American System of the early 1800s

Answers

Answer 1

Answer:

Called Great Compromiser.

Explanation:


Related Questions

Which of the following newspaper headlines is an example of white collar crime?
A.
"Man charged with aggravated assault and burglary"
B.
“Businessman charged with embezzling funds from corporate accounts”
C.
“Wealthy executive charged with child abuse”
D.
“Local Mob Boss charged with extortion, homicide, and grand larceny”

Answers

Answer:

I think that the answer is B

Explanation:

b because rich people so yeah

What is this “check” that Dr. King refers to? How has America defaulted on this check?

Answers

Answer:

dr.'s “Dream” speech used ... “In a sense we've come to our nation's capital to cash a check,” he said, ... “It is obvious today that America has defaulted on this promissory note ...

Explanation:

Pls help with thisssss
Question 8 (5 points)
(01.06 MC)
Use the passage to answer the following question:

"I can see no reason to doubt but the imposition of taxes, whether on trade, or on land, or houses, or ships, on real or personal, fixed ort floating property, in the colonies is absolutely irreconcilable with the rights of the colonists as British subjects and as men. I say men, for in a state of nature no man can take my property from me without my consent: if he does, he deprives me of my liberty and makes me a slave."
—James Otis, 1763

Based on this excerpt, what do you think Otis's purpose was in writing this document? (5 points)

a
To sell

b
To describe

c
To conquer

d
To persuade

Answers

It is to persuade, option D.

According to the map, Italy in the early 19th century was under the control of Austria. under the control of Spain. united as the Kingdom of Italy. split into kingdoms and city-states.

Answers

Answer:

Split into kingdoms and city-states.

Explanation:

In the early 19th century, Italy was split into several small kingdoms, princedoms and city-states, and this had been the political reality of Italy since the Middle Ages.

Some of these smaller Italian states were under the control of foreign powers, like Piedmont, which was controlled by Savoy. However, most of them were more or less independent.

Answer:

Split into kingdoms and city-states.

Explanation:

APPLYING MAIN IDEAS What legislation ended the banking crisis? a. Social Security Act (SSA) c. National Recovery Administration (NRA) b. Works Progress Administration (WPA) d. Emergency Banking Relief Act (EBRA) Please select the best answer from the choices provided A B C D

Answers

Answer:

its D

Explanation:

srry if i got it wrong idc if you give me brainliest i tryed my best


Which of the following describes characteristics of the Great
Depression? *
A). A period of great economic prosperity in the United States in the early 1920's
B). A period of expansion into the western frontier
C). A period characterized by business failures, high unemployment and falling prices
D). A period of civil unrest during the 1960's in the United States

Answers

Answer:

C).

Explanation:

The Great Depression was a time when businesses were failing and many people were unemployed. About 15 million people were unemployed (nearly 20% of the people at the time).

Answer:

C).

Explanation:

The Great Depression was a time when businesses were failing and many people were unemployed.

What protected the United States from becoming involved in European conflicts

Answers

Well, that depends on the time period, but it is probably because of the Foreign Policies. Hope this helped!

1. What does this image say to you? Be specific.
2. Can you relate to this woman and her two children?

3. Approximately how old do you believe this woman to be? Her children? What made you come to that conclusion?

Please Help Its for a DBQ

Answers

Answer:

1. What does this image say to you? Be specific.

The image depicts sadness, despair, economic plight, poverty. It depicts hopelessness. The picture is one of the most famous taken during the Great Depression of the 1930s.

2. Can you relate to this woman and her two children?

She's very likely their mother, for the way that the two children cling to her. If not, she could be their aunt or step-mother. She is definitely not likely to be family unrelated to the children.

3. Approximately how old do you believe this woman to be? Her children? What made you come to that conclusion?

The woman must be in her late 30s or early 40s. The children are probably around 5 or 6. Their ages can be inferred by their physical appearance.

was the american revolution conservative or radical

Answers

it was a conservative movement intended to preserve the existing social, political, and economic power.

Explain how the facts of Santa Fe Independent School District v. Doe and
Engle v. Vitale (1962) led to a similar holding in both cases

Answers

Answer:

Both cases established limits on public schools' actions based on the First Amendment. In both cases, the Supreme Court ruled in favor of limiting religious expression in public schools. C. In both cases, the Supreme Court ruled that the Bill of Rights does not apply to students in public schools.

Explanation:

PART A: What is the central idea of the text? Into Africa

Answers

Answer:

i need this for a challenge

Explanation:

Which of the following Trade Networks went across the Indian Ocean from
South East Asia, South Asia, and East Africa?

Answers

Answer: Silk road

Explanation:

Answer:

east africa

Explanation:

Select the correct answer.

The Taft-Hartley Act intended to do which of the following?


A.

curb the laws that gave too much power to union leaders

B.

grant US veterans benefits upon returning home

C.

provide companies with a way to acquire immigrant labor

D.

give women workers more rights in World War II factories

20 pts if anyone can help me....

Answers

The Taft-Hartley Act was meant to curb the legal guidelines that gave an excessive amount of power to union leaders.

What is the Taft-Hartley Act?

The Labor Management Relations Act of 1947, also called the Taft–Hartley Act, is a United States federal regulation that restricts the sports and electricity of labor unions.

It was enacted with the aid of the eightieth United States Congress over the veto of President Harry S. Truman, turning into regulation on June 23, 1947.

Taft–Hartley was added in the aftermath of a first-rate strike wave in 1945 and 1946. Though it was enacted with the aid of the Republican-managed eightieth Congress.

The regulation obtained good sized help from congressional Democrats, many of whom joined with their Republican colleagues in balloting to override Truman's veto.

The act continued to generate competition after Truman left office, but it stayed in effect. The Taft–Hartley Act amended the 1935 National Labor Relations Act (NLRA), prohibiting unions from engaging in numerous unfair labor practices.

Jurisdictional strikes, wildcat strikes, political strikes, secondary and mass picketing, and economic donations to federal political campaigns using unions are among the practices prohibited by the Taft–Hartley Act.

The NLRA additionally allowed states to enact right-to-paint legal guidelines banning union shops. The regulation was enacted all through the early levels of the Cold War.

Therefore, from the above assertions, it's clear that choice A, decreasing the legal guidelines that gave an excessive amount of power to union leaders, is the ideal choice.

Learn more about Taft-Hartley Act, refer to:

https://brainly.com/question/10748899

Some one plzzzz help
Which diagram best connects a Central Asian country with an important
event from its history?
O

A
Afghanistan
Was part of the
Ottoman Empire through
World War I

B.
Kyrgyzstan
Fought a war against
Azerbaijan in the 1990s

c.
Kazakhstan
Was led by a communist
leader after the fall of the
Soviet Union

D.
Armenia
Was part of the British
Empire until after the
Cold War

Answers

Answer:

C

Explanation:

Nursultan Nazarbayev was the leader of kazakhstan following the collapse of the soviet union.

Answer:

Its C

Explanation:

did the test !!

1. Identify three (3) major weaknesses of the Articles of Confederation. Be sure to give a specific example of each major weakness in your response. (3 pts)

2. Compare the three (3) major plans discussed at the Constitutional Conventions. Be sure to identify each plan & its major proposal, and which plan the delegates eventually agreed upon. (3 pts)

3. Contrast the Federalists and Antifederalists. Be sure to explain how both groups views the Articles of Confederation and Constitution. (2 pts)

4. Compare and contrast the Articles of Confederation & US Constitution. Be sure to identify the basic organization & powers of each Government. (2 pts)

Answers

Answer:

it's the first one Identify three (3)

Explanation:

I'm joking I'm joking I don't know the answer but hey thank you for the free points by the way THANK YOU!!!!!!!!!!!!!!!!!!! :)

Y’all wanna help me with history ? Only if you good!!! Answer #1 and #3 please

Answers

Answer:

1.because highway 66 is the main migration road so they decided to travel through their

2. 2.667 hours (or exactly 160 minutes)

Explanation:

did that help? if not then pls contact me in the comment section

What type of map is this?

Answers

Answer:

Its the map if the US

Explanation:

Its haves the United States.

I think its correct.

I think it might be a map of the world but don’t take my word for it

Why was texas so heavily in debt

Answers

Answer:

From money borrowed to build extravagant sports facilities to rising obligations for government workers' pensions, Texas's state and local debt is increasing at a faster rate than its gross state product, raising fears about the burden on future generations.

Explanation:

please answer please i need help lol

Answers

Just put what you think

50points!!!! PLS HELP !!!!!!!!!




Reread Olaudah Equiano's description of the “Middle Passage,” the transport of captured enslaved people across the Atlantic Ocean. What details stand out to you? In what ways would it have been a difficult passage? Give details. Imagine you werr making a speech as part of the "Sons of Afruca". What would you say to convice others to end the slave trade and free all enslaved people?
mybe 100 points!!!!​

Answers

Answer:

As the official publication of the Division on Black American Literature and Culture of the Modern Language Association, the quarterly journal African American Review promotes a lively exchange among writers and scholars in the arts, humanities, and social sciences who hold diverse perspectives on African American literature and culture. Between 1967 and 1976, the journal appeared under the title Negro American Literature Forum and for the next fifteen years was titled Black American Literature Forum. In 1992, African American Review changed its name for a third time and expanded its mission to include the study of a broader array of cultural formations. Currently, the journal prints essays on African American literature, theatre, film, the visual arts, and culture generally; interviews; poetry; fiction; and book reviews. AAR has received three American Literary Magazine Awards for Editorial Content in the 1990s.

Publisher Information

AAR is published at Indiana State University, a state-assisted Doctoral II institution in the west-central part of the state which enrolls approximately 11,000 undergraduate and graduate students. The largest of the University's seven academic units is the College of Arts and Sciences, which houses twenty-three departments and several research centers, and is home to more than forty percent of the University's declared majors, as well as African American Review.

Explanation:

plz mark brainliest

Answer:

As the official publication of the Division on Black American Literature and Culture of the Modern Language Association, the quarterly journal African American Review promotes a lively exchange among writers and scholars in the arts, humanities, and social sciences who hold diverse perspectives on African American literature and culture. Between 1967 and 1976, the journal appeared under the title Negro American Literature Forum and for the next fifteen years was titled Black American Literature Forum. In 1992, African American Review changed its name for a third time and expanded its mission to include the study of a broader array of cultural formations. Currently, the journal prints essays on African American literature, theatre, film, the visual arts, and culture generally; interviews; poetry; fiction; and book reviews. AAR has received three American Literary Magazine Awards for Editorial Content in the 1990s.

Publisher Information

AAR is published at Indiana State University, a state-assisted Doctoral II institution in the west-central part of the state which enrolls approximately 11,000 undergraduate and graduate students. The largest of the University's seven academic units is the College of Arts and Sciences, which houses twenty-three departments and several research centers, and is home to more than forty percent of the University's declared majors, as well as African American Review.

Explanation:

One of the deciding battles of the French and Indian War was the capture of Quebec by General:
a) Montcalm
b) Braddock
c) Washington
d) Wolfe
which one?

Answers

Answer: braddock

Explanation:

how was the american revolution politically conservative

Answers

Answer:

It was conservative in that it sought to secure the liberties and representative government that Americans believed they already enjoyed and to which Americans believed they had a God-given right.

Yes what the person above me said


Explanation:

Why did the United States still pay Mexico after winning the war?

Answers

Answer:

Explanation: By late 1847, the Americans had captured Mexico City, which made the Mexicans agree to a peace treaty which ceded all of the lands the U.S. had wanted. ... The Americans were outnumbered in nearly every battle they fought. The entire war was fought on Mexican soil, which should have given the Mexicans an advantage.

Answer:

Explanation:

Because the US didn't want the war to look like a war of conquest where they simply took the land from Mexico. Therefore they purchased the land and agreed that they would take on the debt that Mexico had to the people who were previously living in the land.

Drag each label to the correct location on the table.
Match each battle to the US military leader who won it.
Battle of the
Thames
Battle of
Horseshoe
Bend
Battle of New
Orleans
Battle of
Put-in-Bay
Battle of
Tippecanoe
William Henry Harrison
Oliver Perry
Andrew Jackson

Answers

William:

- battle of Thames

- battle of Tippecanoe

Oliver:

- battle of Put-In-Bay

Andrew:

- battle of new Orleans

- battle of Horseshoe bend

Answer:

William:- battle of Thames- battle of TippecanoeOliver:- battle of Put-In-BayAndrew:- battle of new Orleans- battle of Horseshoe bend

Explanation:


In a relationship with low amounts of equity, both individuals equally contribute to making important decisions.
Please select the best answer from the choices provided
OT
OF

Answers

Answer:

False**

Explanation:

Because of low amounts of equality their will be inequality

In a relationship with low amounts of equity, both individuals equally contribute to making important decisions. The statement is false.

What is a relationship foundation?

A relationship is based on th pillars of trsut and understanding where both partners shared common beliefs and hobbies with their own perspectives. Relationships that live longer are based on understanding, care, respect, and responsibility toward each other.

It defines a relationship where equality and respect are subordinated to power and control. Relationships are unequal if one partner's needs take precedence over the other's without any thought for yours.

Power disparities between partners are referred to as inequality in relationships. One spouse maintains authority and authority over the other in an unhealthful relationship.

Therefore, the statement is False.

Learn more about Relationships, here:

https://brainly.com/question/15211678

#SPJ7

I NEED HELP PLEASE The Manhattan Project resulted in which of the following: A) The destruction of Nagasaki and Hiroshima B) The development of the atomic bomb C) Japan's surrender D) All of the above​

Answers

Answer:

All of the above

Explanation:

The Manhattan Project was a collaboration effort made by allied forces to develop a nuclear bomb. When they were finally successful, they used the bombs on Hiroshima and Nagasaki which caused Japan to surrender.

Which statement best describes the cause of China’s distinct cultural identity?

China was a difficult place for trade because the people were modest farmers.
China was separated from other lands and peoples due to the physical geography of the region.
China had a unique culture because the ancient Chinese believed they were the only civilization.
China was protected from outside influence because Chinese people were not allowed to leave.

Answers

Answer:

the first one or the third one

Explanation:

Answer:

A

Explanation:

How did the belief that stocks were overvalued in the late 1920s effect the American economy?


A- Companies made huge profits on stock speculation.
B- People held on to their stocks, hoping for profits.
C- People began questioning the value of the stocks they owned.
D- Businesses refused to sell their company stocks.

Answers

It is A because if you look at the paragraph hope this helps

Answer:

The correct answer is B, I am taking the test on edge right now.

Explanation:

What does the nazi symbol mean since I can’t find no specific question?

Answers

Answer:

The Swastika originates from Hindu Culture which can have a different meaning on its interpretation (Such as which way it is facing.) It is more recognizable by the means of the NSDAP and specifically Adolf Hitler. They have converted a symbol from Hindu culture to a sign of Nazism and National Socialism. This symbol can still be seen used in Hindu structures and countries like Nepal for example.

Laws are passed to regulate the funding of political campaigns in an effort to ensure that

only a handful of candidates run for office.
all candidates who run for office have equal funding.
corporations and the wealthy cannot donate an excessive amount.
candidates focus on the day’s controversial issues

Answers

Answer: C) corporations and the wealthy cannot donate an excessive amount.

Unfortunately there are loopholes that allow things like super PACs to form, but ideally such laws are aimed to prevent very wealthy people/corporations from exercising too much heavy influence on elections and politics in general. This would then lead to a more fair balanced playing field.

Answer:c

Explanation:on edge

Other Questions
write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC how is the light from a grow bulb different from light from the sun. What is indirect object word order? (Latin) local AM radio station broadcasts at a frequency of 685.9 kHz. Calculate the wavelength at which they are broadcasting. Wavelength A car wash can wash four cars in one hour. The table shows the total number of cars washed. How long will it take to wash 24 cars? HELLPPP PLEASE WILL GIVE BRAINLIEST Diffraction is useful in which of the following fields?a. calculusb. anthropologyc. astronomyd. astrology PLEASE HELPI think the answer is either 18 pounds or 26The scatter plot shows the weight of a baby panda in the months after it is born. How much would you expect a 5 month old baby panda to weigh? What is 10 divided by 5/8 The radius of a circle is 8 miles. What is the circle's circumference? 10 when solving the equation, what property was used to go from Step 2to Step 3?Step 1: -(2x + 3) = x - 18Step 2: -2x - 3 = x - 18Step 3: -3 = 3x - 18A. Addition Property of EqualityB. Subtraction Property of Equalityc. Multiplication Property of EqualityD. Division Property of Equality Help! Ms.Day drew a rectangle on the board with a width of 14 cm and a digo al length of 50 cm. Find the length of this rectangle in centimeters. electron configuration for Li Of the four religions, which one did not exist in Arabia before Muhammad?Group of answer choicesPaganismIslamChristianityJudaism People and states should retain as many rights as possible.FederalistorDemocratic - Republican What is the measure of Angle HEG? Which of the equations is graphed below?A. y=-2x + (1)/(2)B. y = -2x 1C. y=-2x-(1)/(2)D. y = -2x + 1 I WILL GIVE BRAINLIEST TI RIGHT ANSWER write an equation of the line in a slope intercept form has a slope of -6 and passes through the point (2, -4) Find the value of x using the pythagorean theorem.Do the side lengths form a pythagorean triple? When you write headlines, always write in ________ __________. afuture voice bpassive voice cpresent tense dpast tense