Which of the following changes takes place during the first trimester of awoman's pregnancy?A. The placenta attaches to the mother and nourishes the growingfetus.B. The fetus begins rhythmic breathing movements.C. The mother feels the fetus move for the first timeD. The fetus develops toenails, lips, and eyelashes.

Answer:

Germination

Explanation:

The beggining growth of the plant

Answer:

Germination

Explanation:

It's when the seed takes water from the soil. This trigger root growth to allow the seed get more water. It then develops and grows towards the sun above ground

Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.

Mutation 1

5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'

Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.

3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'

Same sequence but from 5' - 3':

5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'

Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:

Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys

It should be noted that each chain will give rise to different amino acid sequences.

Myelin, which is composed of Schwann cells, is an insulating layer that surrounds portions of the brain's axons. A protective covering known as myelin is produced by Schwann cells in the peripheral nervous system.

A protective layer or sheath called myelin develops around nerves, including those in the brain and spinal cord. It is composed of fatty and protein components. Electrical impulses may move swiftly and effectively along nerve cells because to its myelin layer.

Schwann cells make myelin in the peripheral nervous system (PNS: nerves) and oligodendrocytes in the central nervous system (CNS: brain and spinal cord). In the PNS, one Schwann cell forms a single myelin sheath

To learn more about Myelin; Schwann cells refer to:

https://brainly.com/question/12970137

#SPJ13

Answer and explanation

Endoplasmic reticulum (ER) is a tubulus membrane that is found in the cytoplasm of the Eukaryote. It's structure consists of the nuclear envelope and the pheripheral endoplasmic reticulum.

Endoplasmic reticulum is divided into 1. smooth ER and 2. rough ER

1. Rough ER - has large numbers of ribosomes attached to the outer surfaces of the lamella membranes, this is the area of ribosomes important for protein production, storage and export. The modified proteins move slowly along the inside of the rough ER until they are packed into small vesicles of the endoplasmic reticulum. After packaging, the proteins are moved by elements of the cytoskeleton either to the Golgi apparatus or to the plasma membrane.

2. Smooth ER - Is involved in the synthesis of steroid. On the surface of smooth ER, there are no ribosomes, therefore it does not participate in the formation of proteins. Its function is to contains many enzymes and other proteins, in liver cells, that have the ability to detoxify a wide range of drugs and poisons.

In order to answer this question, we must remember a bit of cellular metabolism, when mitochondria carry out the process of cellular respiration we can see that in the electron transport chain the final acceptor of electrons is oxygen. Therefore the correct answer for the question is option D oxygen.

Energy exists in different forms, some of which are electrical, heating, chemical, luminous, among others.

Chemical energy in biological systems is based on the formation-breaking of bonds: to form a bond, energy must be expended, while when a bond is broken, energy is released.

Often, these processes require the participation of enzymes within the organisms; enzymes are proteins that decrease the activation energy of a reaction. For example, if a lot of energy is needed to break a bond, the enzyme will help to lower the energy required.

In biological systems such as humans, the energy molecule is ATP, which releases energy when a bond is broken and a phosphate group is released, leaving ADP as a product. And although it is an efficient process, the laws of thermodynamics explain that no process is 100% efficient, and therefore, some amount of energy is always released in the form of heat. Unlike chemical energy, heat energy is not stored in bonds and cannot be catalyzed by enzymes or utilized by biological systems.

Answer:

The B is the correct ANSWER.

Explanation:

Answer:B

Explanation:Science

Hair cells best describe as they are epithelial, but function like neurons

The basic sensory receptor cells in the inner ear, known as hair cells, transduce, or change into electrical impulses that are sent to the brain, mechanical sensations generated by sound and head motions.

Learn more about Hair cells here:

https://brainly.com/question/28496027

#SPJ13

As we know there are B cells and T cells are part of the immune system, B cells elaborate antibodies meanwhile T cells destroy infected cells: Therefore we can say that the correct answer is a.

Answer:

In living things, diffusion allows substances to move in and out of cells. It's how red blood cells distribute oxygen through the body. When empty blood cells enter the lungs, which have an extremely high concentration of oxygen, the molecules pass into the blood cells, filling them up.

Explanation:

Eukaryotes have a nucleous.

One of the main differences between eukaryote and prokaryote cels is that the first ones have nucleous and se second ones don`t.

Cells membranes are a phospholipid bilayer, with the hydrophobic "tails" of the phospholipids oriented to the interior of the bilayer, and the hydrophilic "heads" to the exterior of the bilayer.

They are fluid, which means that other molecules in them, such as proteins, are not fixed in position. One of the components of the membrane in animal cells is cholesterol, which helps to give rigidity and strength to the membrane

The cell membrane is impermeable to ions and polar molecules, while hydrophobic molecules can pass by passive diffusion.

This means that only statement 2 is true (option b).

Answer:

water will leave the blood vesseld

Answer:

Kudzu was intentionally introduced to North America by the Soil Erosion Service and Civilian Conservation Corps in the 1930s for the purpose of controlling soil erosion in the American Southeast.

In this case, we have the major groups of plants, many characters have defined the appearance of each group however there are some traits that are too important and those are mentioned here.

In the base is algae, when the retention of the Zygote occurs plants started to evolve when plants started to evolve in earth bryophyte came to be, however they do not possess a proper vascular system, this occurred with pteridophytes (ferns and so forth), nonetheless still produced spores, angiosperms reduced gametes and pollen came as innovation, however, they produced strobili, so the innovation of angiosperms were flowers.

Triglycerides are the molecules that provide the greatest energy storage capacity in animal cells.

Triglycerides are the type of fat also called lipids that are found in your blood. When you eat, your body converts calories that it does not need to use into triglyceride molecules. The triglycerides are stored in the fat cells. After the hormones release triglycerides for energy between eating. Sugary food, sweat drinks, saturated fats, refined grains, alcohol, and foods having high-calorie all lead to high levels of triglycerides. The healthcare provider classifies high triglyceride levels i.e. Mild levels as 150-199 mg/dL, Moderate level has 200-499 mg/dL, and Severe levels has Greater than 500 mg/dL. Very high triglycerides may cause blocking of the blood supply to the heart or brain. Symptoms of lower blood supply to your heart could be chest pain.

So we can conclude that option C is the correct answer.

Learn more about energy here: https://brainly.com/question/13881533

#SPJ1

The correct option that represents the largest to the smallest, in terms of size is a.

Gel electrophoresis is a method useful to separate DNA fragments according to molecular size. Thus, the answer is gel electrophoresis.

Answer: Gel Electrophoresis

Explanation:

Gel electrophoresis,specifically agarose gel electrophoresis, runs DNA through a gel matrix towards a positive electrode because DNA is negatively charged. The larger the DNA molecule is the slower it will move through the gel, thus separating DNA by its size.

Polymerase Chain Reaction (PCR) is a technique used to amplify (replicate) a DNA segment many times over using DNA polymerase.

Transformation of Recombinant DNA is referring to inserting DNA into a cell. This can be done with numerous methods such as heat shock and electroporation.

The participant is having cramps in the muscles due to running and increased blood glucose level with the decreased oxygen saturation as it is an anaerobic exercise.

Overuse of a muscle, dehydration, and muscle strain or holding the same position for a prolonged period of time can cause a muscle cramp. In many cases, the cause of it isn't known. Although most of the muscle cramps are harmless, some of them may be related to an underlying condition, such as inadequate blood supply, compressed nerve, etc.

Reasons for the cramping of muscles are straining of muscle, compression of nerves, injuries in the spinal cord or a pinched nerve in the neck, Dehydration, or Low levels of electrolytes such as magnesium, potassium, or calcium.

Learn more about Running here:

https://brainly.com/question/15573179

#SPJ1

Answer: D. Facilitated Diffusion​

Explanation: Two classes of proteins that mediate facilitated diffusion are generally distinguished: carrier proteins and channel proteins.

Given the characteristics provided: a spinal column and climbing walls; we can classify the gecko as a vertebrate because it has a spinal column (option D).

To make a more specific classification, we would need to know more characteristics of the gecko.

Answer: An estate plan is a collection of documents and includes a will, guardianship designations, healthcare power of attorney, beneficiary designations, durable power of attorney, and a personal letter of intent, outlining your wishes, should you die or become incapacitated.

Explanation: i tryed my best

The correct answer is B. sugar molecules are broken down to produce ATP. In cellular respiration sugars are broken down. During the process, they release energy that allows the cell to produce ATP.

The key difference  is that aerobic respiration requires oxygen, and anaerobic respiration does not.

Aerobic respiration in a cell is when glucose breaks down with help of oxygen and yields carbon dioxide, water, and with the release of energy. Thus end products are [tex]CO_2}[/tex] and [tex]H_{2}O[/tex] .The process of releasing energy takes a much longer time. Example it occurs in plants and animals.

Anaerobic respiration  in a cell, is the process of breaking down  glucose without the use of oxygen then it yields to the end products  [tex]CO_{2}[/tex] (carbon dioxide), alcohol and energy. It is a fast process. Example human muscle cells, and bacteria.

The equation for aerobic cellular respiration
[tex]C_{6} H_{12} O_{6} + 6O_{2}[/tex] ⇒ [tex]6CO_{2} + 6H_{2}O[/tex] + ATP(energy)
Glucose   + oxygen ⇒ carbon dioxide + water +energy.

learn more about aerobic and anaerobic respiration at
brainly.com/question/28688557

The true statement about the intracellular transport is option C. kinesin and dynein move substances along microtubules.

Intracellular transport is the movement of vesicles and materials within a cell. Intracellular shipping is needed for preserving homeostasis in the cellular by responding to physiological alerts.

The primary difference between intercellular and extracellular fluid is that intracellular fluid is the liquid found in the cell whereas extracellular fluid refers to all the frame fluids outdoor the cell. Intracellular transport is important for maintaining the right mobile function in maximum eukaryotic cells, with perturbations in lively shipping ensuing in several kinds of sickness.

Cytoskeleton Determines the location of Organelles inside the mobile. Intracellular shipping of molecules and organelles is liable for their delivery to vacation spot websites.

Learn more about intracellular transport here:-https://brainly.com/question/25802833

#SPJ4

Deforestation is the main cause of soil erosion. Without plant cover, there will be an occurence of erosion that will sweep the land into rivers. Trees and their roots gives the soil a defense and refuge from the wind and rain. When forest are eradicated, it makes the land exposed and vulnerable of being washed away by elements. Logging exposes soil to rain splash which lossens soil particles. It erodes the soil making a more impermeable bare surface that increase runoff.

Answer:

probably not

Explanation:

When a velocity's magnitude and direction do not alter over time, it is said to be constant.

Constant speed refers to a speed that remains constant throughout the duration of the motion. Constant speed is demonstrated in our example of using cruise control while driving a car.

When a velocity's magnitude and direction do not alter over time, it is said to be constant. In other words, this occurs when an object's rate of change in location remains constant throughout time.

An object is considered to be moving at a constant speed when it covers the same distance in the same amount of time. When moving at a constant place, an object covers a certain distance in a fixed amount of time. S = dt is a formula that can be used to express the speed.

To learn more about Constant speed refer to:

https://brainly.com/question/13672913

#SPJ13

Butter is a dairy product and is elaborated from milk's fat, if we look at the commercial butter we can see is not pure white but a light yellow, which is the color of animal fat.

The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.

This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.

An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.

Read more about Ecosystem here https://brainly.com/question/842527

#SPJ1