Answer:
strogen and progesterone levels
Explanation:
she stressed to her doctor
The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!
Answer:
The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell
Explanation:
Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.
What is Plasma Membrane?Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.
The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.
The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.
Therefore, correct option is A.
Learn more about Plasma membrane here:
https://brainly.com/question/24588191
#SPJ5
Identify the labeled structures.
A: B: C: D: E:
The multiple questions are the same for each question. Please help!
Answer:
e cell wall that is the only one I am sure of because I can hardly see the rest
What is the relationship between a person's PULSE RATE and his or her HEART BEAT? A. The heart beat is always double the pulse rate. B. The heart beat and pulse rate may change, but are always equal. C. The heart beat is always half of the pulse rate. D. There is no relationship between the heart beat and the pulse rate.
Answer:
B. The heart beat and pulse rate may change, but are always equal.
Hope this helps :D Have a fantastic day
In mature animals when do cells still need to differentiate?
Answer:
As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.
Explanation:
''.''
In mature animals cells differentiate during : Repair and replacement of animal cells
Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.
While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.
Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.
Learn more : https://brainly.com/question/19015367
A body cell has been growing and synthesizing proteins. In the nucleus of this body cell, DNA replication is taking place, and a copy of the cell's genetic material is copied. Which of the following is the best conclusion you can make about the life cycle of this cell?
The best conclusion you can make about the life cycle of this cell is that the cell is in the S phase of interphase and will move next to the G2 phase.
S phase (Synthesis Phase) is the phase of the cell cycle in which all of the chromosomes (DNA) are replicated within the nucleus. During this phase, the DNA is effectively doubled as each chromosome contains two sister chromatids. After the S phase, the cell enters the G2 phase where various proteins (such as microtubules) are synthesized.
Which of the following provides the best summary of the process of natural
selection?
A. Populations become better adapted to their environment.
B. Individuals pass on their best traits to their offspring.
C. Individuals always change in response to their environment.
D. Population sizes increase with every generation.
SUBMI
Answer:
c
Explanation:
Which of these variables might affect the amount of solar
energy reaching a particular place on Earth's surface?
A. latitude
B. tilt of Earth's axis
C. time of day
D. weather conditions, such as cloud cover
Answer:
B. tilt of Earth's axis.
Explanation:
Solar radiation, or insolation, is the “fuel” of all solar energy systems. The performance of solar photovoltaic systems which generate electricity and solar thermal systems which produce hot water all depend on the availability and intensity of solar radiation.
how has selective breeding contributed to a wide variety of dog breeds?
Answer:
In the same way that inbreeding among human populations can increase the frequency of normally rare genes that cause diseases, the selective breeding that created the hundreds of modern dog breeds has put purebred dogs at risk for a large number of health problems, affecting both body and behavior.
please help me!! 15 points!
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
Which pair of waves could overlap to produce a wave with a higher amplitude through interference?
Answer:
D: Two waves of the same amplitude with crests that are perfectly aligned
Explanation:
A P E X
What would be the concern if a high percentage of cells were in some phase of Mitosis?
Answer:
When cell division goes wrong, harmful mutations affect the daughter cells
When these errors are not corrected, one of the daughter cells will be born lacking a particular chromosome while the other will inherit an extra copy of the chromosome
Explanation:
What change to the following molecule's structure would result in a saturated fat?
Answer:
It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.
Explanation:
Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.
Hope this helped :)
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?
Answer: The basic answer could be because of the tectonics plates.
Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.
Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.
Why are rocks folded?Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.
Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.
Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.
Learn more about rocks, here:
https://brainly.com/question/29561452
#SPJ2
Organs are comprised of tissues that work together to perform a specific bodily function. true or false?
Answer:
I do believe that is true.
Explanation:
In the diagram which of the following is the secondary consumer
The caterpillar
The Snake
The Leaf
The Mongoose
Answer:
THE ANSWER IS THE SNAKE
Explanation:
PLEASE MARK ME AS BRAINLIEST
(04.02 LC)
What is a genetically modified organism? (2 points)
Answer:
organism whose genetic material has been altered so do not have pure natural genome.
what would happen if an electric fish was always negatively charged instead?
Answer:
Electric eels are part of a group of animals called electric fish.These cells pump positively charged sodium atoms, called ions, from inside themselves to the outside.
Explanation:
Brainliest? plz
Electric fish is a part of the group of animals which are responsible for producing charge. These organisms pump positively charged sodium ions from inside themselves to the outside environment.
What is electric fish?
An electric fish is an fish that can generate electric fields and transfer current through themselves. Most of the electric fishes are electroreceptive, which means that these fishes can sense the electric fields present in the environment. The only exception here is the stargazer family which is not electroreceptive.
The examples of electric fish includes Electric eel, that belongs to the genus Electrophorus, South American knifefishes responsible for the production of powerful electric shocks to stun prey.
If the electric fishes are supplied with the negative charge always then they will pump positive charge to neutralize the effect of that charge.
Learn more about Electric fish here:
https://brainly.com/question/14788080
#SPJ2
Lloyds lab partner is looking down into a test tube while he hears the contents by using a flame. Which action should Lloyd recommend to his partner if heating must continue?
Answer:
To stop looking throught the test tube. lol
Explanation:
together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?.
Answer: The spread of Christianity among the Jews was the heroic act of San Vitores.
Explanation:
He was murdered on the island of Guam on 2 April 1672. He brought Christianity to the CHamoru people. He was killed by the chief's daughter Mata' pang with a sword. His conversion efforts were commendable. The CHamorus people welcomed San Vitores and hundreds of people were readily converted into Christians readily. Today Catholism is the main religion in Guam.
how do gray whales migrate?
Answer: Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.
Explanation:
LI:
The diagram below compares the relative diameters of two planets in our solar system.
Which two planets have diameters that most closely resemble this comparison?
1.
Uranus and Neptune
2.
Jupiter and Saturn
3
Earth and Mars
4.
Mercury and Venus
Submit Answer
Answer:
1, uranus and neptune
Explanation:
i just did it
Based on the diagram above, the two planets having diameters that most closely resemble this comparison are: 1. Uranus and Neptune.
A solar system is an astronomical system which comprises both the inner and outer planets alongside celestial bodies such as a Moon, that are typically in orbit (traveling) around the Sun in slightly elliptical orbits..
Basically, the nine (9) planets that are found in the solar system orbiting around the sun include;
Mercury. Venus. Earth. Mars.Jupiter.Saturn.Uranus.Neptune.Pluto.Generally, the planets found in the solar system vary considerably in terms of shape and size as shown below:
1. Uranus and Neptune: the mean diameter of Uranus is 50,724 km (31,518.43 mi) while that of Neptune is 49,244 km (30598.8 mi).
2. Jupiter and Saturn: the mean diameter of Jupiter is 142,984 km (88,846 mi) while that of Saturn is 120,536 km (74897.6 mi).
3. Earth and Mars: the mean diameter of Earth is 12,756 km (7926 mi) while that of Mars is 6779 km (4212.275 mi).
4. Mercury and Venus: the mean diameter of Mercury is 4,879 km (3031.67 mi) while that of Venus is 12,104 km (7521 mi).
From the above data on diameter, we can deduce that both Uranus and Neptune are mostly related in terms of size as depicted in the diagram, by using two (2) circles of equal sizes.
Read more: https://brainly.com/question/1251115
The cell part that helps with cell division is the ________
Answer:
centrioles
Explanation:
Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.
Which chemical bond most likely stores the most energy?
A. C=C
B. C-C
C. H-H
D. H-O
Answer:
The chemical bond which stores more energy is the Double carbon-carbon bond.
Explanation:
NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?
2.How do you think that the one species of finch evolved into many different species, each with its own advantages?
3. In what ways do these advantages help the finches to survive and reproduce?
4. What might have happened if the finches didn't evolve into many different species?
Answer:
1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.
2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection
3. Medium ground finches with larger beaks could take advantage of alternate food
4. three species of Darwin's tree finches have been known to inhabit Floreana but no birds singing that song on Floreana have been heard in many years.
Explanation:
Do all cells divide at the same rate? Explain
Help
Answer:
No, all cells do not divide at the same rate. Cells that require frequent replenishing, such as skin or intestinal cells, may only take roughly twelve hours to complete a cell cycle.
Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.
Answer:
genes are segments of chromosomes that form tight coils called dna
The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:
Genes are segments of chromosomes that form tight coils called DNA.Thus, the correct option is D.
What is Chromosome?A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.
Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.
Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.
All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.
Therefore, the correct option for this question is D.
To learn more about Chromosomes, refer to the link:
https://brainly.com/question/11912112
#SPJ6
When the dry and wet bulb temperatures are far apart. the humidity is high.
True
False
9. The Sun's outward pressure of radiation is balanced by an inward pressure provided by
gravity
O fusion
fission
oxidation