A Cinco de Mayo parade has 140 dancers. The
dancers are 35% of the people marching in the
parade.
What is the total number of people marching?

Answers

Answer 1

The total of people in the Cinco de Mayo parade if there are 140 dancers and these represent the 35% is 400.

How do I find out the total of people in the parade?

This information can be known by using the information given about the dancers and a rule of three.

In this case, we know 140 dancers are equal to 35%. This means:

140 = 35 %

 x    = 100 %

x= 140 x 100 = 35

x= 14000 / 35 = 400

This means 400 are the total people in the parade.

Learn more about Cinco de Mayo in https://brainly.com/question/440893


Related Questions

Repost of the last question.. Sorry it wasn't full.

someobe please help me here​

Answers

Answer:

[tex]y < -\frac{4}{5} x+4[/tex]

Step-by-step explanation:

To graph the equation, draw the line [tex]y = -\frac{4}{5} x+4[/tex] and shade in the lower left part of the graph under the line to illustrate the inequality

Then pick two points to test

Madison is buying a laptop for $586. He paid for the laptop
using four $100 bills, fifteen $10 bills and forty-six $1 bills. How
much did Madison pay?

Answers

She paid 596 dollars

What is the missing numbers in the synthetic division problem below?

Answers

Answer:

A. 9

Explanation:

2×4=8 and 8+1=9 so that's it.

3. How many y-values are there
for each x-value in the function
represented by the graph?
(A) 0
(C) 2
(B) 1
0 infinitely many

Answers

B. 1 because at each x-value there is only one y-value

4
3
С
2
1
In the similarity
transformation of AABC
to ADEF, AABC was dilated by
a scale factor of [?], reflected
across the [ ], and moved
through the translation [ ].
B.
A
-7
-6
-5
-4
-2
-1 0
1
2
3
+
E
D
-2
-3
F
A. 2
B. 1/2
C. 3
D. 1/3

Answers

Answer: A

Step-by-step explanation:

Since DE=4 and AB=2, we know the scale factor of the dilation was 4/2 = 2.

(57x2:3)+32x450-[39-(4+2):2[+8=

Answers

Answer:

57×2/3+32×450-[39-4+2]/2+8

57×2/3+32×450-(39-6/2)+8

57×2/3+32×450-36+8

57×2/3+14400-28

57×2/3+14372

38+14372

14410

please help with this

Answers

Answer:

1. 120[tex]m^{2}[/tex]

2. 192[tex]ft^{2}[/tex]

3. 48[tex]cm^{2}[/tex]

Step-by-step explanation:

First triangle:

1. Find out the height

   [tex]h^{2} +8^{2} =17^{2}[/tex]

   [tex]h^2+64=289[/tex]

         -64     -64

   [tex]h^2=225[/tex]

  h=15

2. Find the area

A=1/2 x 16 x 15

A=120[tex]m^{2}[/tex]

Second triangle:

1. Find out the height

   [tex]h^2+16^{2} =20^{2}[/tex]

   [tex]h^2+256=400[/tex]

         -256   -256

   [tex]h^{2} =144[/tex]

   h=12

2. Find the area

A=1/2 x 32 x 12

A=192[tex]ft^{2}[/tex]

Third triangle:

1. Find out the height

[tex]h^2+6^2=10^{2}[/tex]

[tex]h^2+36=100\\[/tex]

     -36    -36

[tex]h^2=64[/tex]

h=8

2. Find the area

A=1/2 x 12 x 8

A=48[tex]cm^{2}[/tex]

new shopping mall is considering setting up an information desk manned by one employee. Based upon information obtained from similar information desks, it is believed that people will arrive at the desk at a rate of 20 per hour. It takes an average of 2 minutes to answer a question. It is assumed that the arrivals follow a Poisson distribution and answer times are exponentially distributed.
a Find the probability that the employee is idle.

Answers

The probability that the employee is idle in the shopping mall based on the information given will be 0.33.

How to calculate probability?

From the information given, it is believed that people will arrive at the desk at a rate of 20 per hour and that it takes an average of 2 minutes to answer a question.

Therefore, the probability that the employee is idle will be:

= 1 - (20/30)

= 1 - 0.67

= 0.33

Therefore, probability that the employee is idle is 0.33.

Learn more about probability on:

https://brainly.com/question/24756209

Tony needs to buy hotdogs and hotdog buns for his cookout

Answers

Answer:

then what happened next so I can answer your questions

Answer:

Do you have any more information on this question so we can answer it for you?

Find the probability of a couple having at least one boy when a couple has three children

Answers

If you have one child you either have a boy or girl can you tell me the chance of having a boy
I am asking this to have an understanding of what you know

Answer:

7/8

Step-by-step explanation:

assuming the probability of getting a boy and girl is 50 50,

(1/2)^3=1/8

1-1/8=7/8

what is the hardest part of math

Answers

Answer:

Trying to learn it math isint about learning a eqution. its about expanding your mind and making you think.

Step-by-step explanation:

Hope it helps:)

Solve the follow inequality. ∣3x−4∣≥8

Answers

Hello.

Let's solve the absolute value inequality.

In order to do that, let's imagine that |3x-4| is positive.

Since the absolute value of |3x-4| is 3x-4, we write 3x-4 and solve:

[tex]\mathrm{3x-4\geq 8}[/tex]

Now, move -4 to the right, using the opposite operation:

[tex]\mathrm{3x\geq 8+4}[/tex]

Add:

[tex]\mathrm{3x\geq 12}[/tex]

Divide both sides by 3:

[tex]\mathrm{x\geq 4}[/tex]

However, this is only 1 solution.

Let's imagine that |3x-4| is a negative number.

So, the inequality looks like so:

[tex]\mathrm{-3x+4\geq 8}[/tex]

Move 4 to the right:

[tex]\mathrm{-3x\geq 8-4}[/tex]

[tex]\mathrm{-3x\geq 4}[/tex]

Divide both sides by -3:

[tex]\mathrm{x\leq \displaystyle-\frac{4}{3} }[/tex]

Therefore, the solutions are

[tex]\mathrm{x\geq 4}\\\mathrm{x\leq \displaystyle-\frac{4}{3} }[/tex]

[tex]\bigstar[/tex] Note:

If we divide both sides of an inequality by a negative number, we flip the inequality sign.

I hope this helps you.

Have a nice day.

[tex]\boxed{imperturbability}[/tex]

X>=4
First step- Add 4 to both sides
Simply-3x>=12
Divide both sides by 3- 3x/3 12/3
X>=4 is final answer

There are 90 kids in the band. 20% of the kids own their own instruments, and the rest rent them.How many kids own their own instruments?

Answers

Answer:

18 kids

Step-by-step explanation:

because you multiply 0.2 by 90 and it equals 18

Pls help me and thanks rounding

Answers

Answer:

Step-by-step explanation:

1399 rounds to 1400 so A is not the answer

1449 rounds to 1400 so B is not the answer

1589 rounds to 1600 so D is not the answer

The hundreds place is second from the left. Third from the left determines what happens to second from the left. 5 and over round up. Less than 5 just use the first 2 digits left and 2 zeros.

The answer is C

1457 rounds to 1500

1547 rounds to 1500

Which equation has the same solution as x^2 - 6x - 14 = 0?

A (x + 3)^2 = 23

B (x - 3)^2 = 23

C(x + 3)^2 = 5

D (x-3)^2 = 5​

Answers

Answer: B

Step-by-step explanation:

[tex]x^{2}-6x-14=(x-3)^{2}-14-9=(x-3)^{2}-23[/tex]

For any real number c, sqrt c^2 =
A. I
B. ?
C. c
D. 1

Answers

Answer:

option A. |c| is the answer.

because sqrt of any number is always positive. that's why we add the modulas symbol around the interger.

-7 < 3x + 2 < 5.
Solve for x

Answers

Answer:

-3 < x < 1, This is the domain

2 When you multiply a a number by 7 and add 8 to the answer, you get 50. What is the number?​

Answers

Answer:6

Step-by-step explanation:

the correct answer would be 6. Step-by-step explanation: when 7 is multiplied by 6 it gives 42 ,then we have to add 8 to the product and it gives 50

ABC is a straight line where BC = 3AB. OA = a, AB = b Express OC in terms of a and b.​

Answers

That would be 3AB because of the expression you have

How many solutions does the nonlinear system of equations graphed below
have?
A. Two
B. Zero
C. One
D. Four

Answers

The solutions of a system of equations is also the intersection of the two lines. In this case the red parabola and the blue linear equation intersects at One point and there fore the answer is C.) One

I hope it helped, if you need more explanation just comment and I will try to explain better!

Type the single exponent that would appear on the 7: *

7^5 (exponent 5) x 7^6 (exponent 6) x 7^2 (exponent 2)
7^5 x 7^6 x 7^2

Do I add the exponent or multiply?

Answers

You add the exponent. You never multiply it.

Hope this helps!

Say, mind doing me a favor and clicking the brainliest button for me? It would help me tons.

~~~PicklePoppers~~~

what are the zeros of f(x)=x^2+2x-80

Answers

Answer:

The zeros are 8 and -10, all u have to do is substitute x for those values, factor it, or graph it.

Step-by-step explanation:

Hank is painting houses this summer. He can paint 7 houses in 5 weeks. At this rate, how many houses did he paint in 18 weeks?

Answers

[tex]\begin{array}{ccll} houses&weeks\\ \cline{1-2} 7&5\\ x&18 \end{array}\implies \cfrac{7}{x}=\cfrac{5}{18}\implies 126=5x \\\\\\ \cfrac{126}{5}=x\implies 25\frac{1}{5}=x[/tex]

Help please with explanations

Answers

The length of the segment AC is 4√3, so the correct option is E.

How to get the length of AC?

In the image, you can see a right triangle.

We do know that AB = 8 units, and BC is equal to the radius of the circle.

We also know that the area of the circle is 16pi, and the area of a circle of radius R is:

A = pi*R^2

Replacing our area, we get:

16pi = pi*R^2

16 = R^2

√16 = R = 4.

So the radius of the circle is 4, which means that BC = 4.

Now we can use the Pythagorean theorem, that says that the sum of the squares of the cathetus is equal to the square of the hypotenuse, this can be written as:

AB^2 = BC^2 + AC^2

8^2 = 4^2 + AC^2

64 - 16 = AC^2

√48 = AC

√(3*16) = AC

4√3 = AC

So the correct option is E.

If you want to learn more about right triangles, you can read:

https://brainly.com/question/2217700

x/3 = 2,how to calculate x?
please help me

Answers

Answer:

[tex]\displaystyle{ \frac{x}{3} = 2}[/tex]

[tex]x = 2 \times 3[/tex]

[tex]x = 6[/tex]

Let's check:-

[tex]\displaystyle{ \frac{x}{3} = 2 }[/tex]

[tex]\displaystyle{ \frac{6}{3} = 2 } [/tex]

[tex] = > 2 = 2[/tex]

The length of the sides of a polygon are in the ratio of 3: 4: 2: 5. If the perimeter is 84 cm, find the N length of the shortest side​

Answers

Answer:

12 cm

Step-by-step explanation:

First, divide the perimeter by the sum of ratios.

=> 84 / (3 + 4 + 2 + 5)

=> 84 / 14

=> 6

Shortest side

= 2x

= 2(6)

= 12 cm

1. what is the y-intercept of this line?

2. what is the slope of this line?

3. what is the equation for this line?

Answers

Step-by-step explanation:

1. The y-intercept is the value for y when x = 0.

When x = 0, y equals 7.

Represented as:

(0, 7)

2. How to find the Slope?

Find 2 points on the graph then use the slope formula.

[tex] \frac{y2}{x2} - \frac{y1}{x1} = m[/tex]

m = slope

2 points:

(0, 7)

(2, 3)

Substitute the points into the formula:

[tex] \frac{3}{2} - \frac{7}{0} = m[/tex]

Subtract:

[tex] \frac{ - 4}{2} = m[/tex]

[tex] \frac{ - 4}{2} = m[/tex]Simplify:

[tex] \frac{ - 4 \div 2}{2 \div 2} = - \frac{2}{1} [/tex]

The slope is -2.

Forming an equation:

Use the slope-intercept format.

[tex]y = mx + b[/tex]

m = slope

b = y-intercept

Substitute 7 for b, and -2 for m.

[tex]y = - 2x + 7[/tex]

evauluate the equation r/15 = (-3)
A. r=45
B. r = 18
C. r = -18
D. r = -45​

Answers

Answer:

The choice D. r= - 45

Step-by-step explanation:

[tex] \frac{r}{15} = ( - 3) \\ \\ r = ( - 3) \times 15 \\ \\ r = - 45[/tex]

An employee works as a teacher at an online school making $38,900 per year. However, the school is hiring a principal at a salary of $59,500 per year.

The employee went back to school to become a principal.

How much more money could the employee make working as a principal instead of a teacher over 5 years?

Enter your answer in the box

Answers

Answer:

$103,000

Step-by-step explanation:

teacher : 38,900 x 5 = 194,500

principal : 59,500 x 5 = 297,500

$297,500 - $194,500 = $103,000 more

What’s the correct answer for this question?

Answers

Answer:

Absolute change: $1,700

Relative change: 7.6577%

Step-by-step explanation:

Absolute change: $22,200 - $20,500 = $1,700

Relative change: (100 × $1,700) : $22,200 ≈ 7.6577%

Other Questions
6 The system of equations shown below has no solution.Change one number in one of the equations so that thesystem has one solution. Graph your new system onthe coordinate grid to support your answer.y= 2x 1y = 2x + 1 use your knowledge of the root sens ("to feel"), occurring in such words as sense and sensory, along with context clues, to find the meaning of sensuous in the text brainly Figure out the next question What role did the Germanic tribes play in the fall of Rome? What artistic styles are traditionally most common in Islamicart? Select all true answers.GeometricStylizedNaturalisticFigurative1 pts A particle with a charge of +7.4 C is separated from another charged particle with a charge of-3.6 uC by a distance of 1.4 m. Find the direction and the magnitude of electrostatic forcebetween the particles. P1-1A On April 1, Julie Spengel established Spengel's Travel Agency. The following trans-actions were completed during the month.1. Invested $15,000 cash to start the agency.2. Paid $600 cash for April office rent.3. Purchased equipment for $3,000 cash.4. Incurred $700 of advertising costs in the Chicago Tribune, on account.5. Paid $900 cash for office supplies.6. Performed services worth $10,000: $3,000 cash is received from customers, and thebalance of $7,000 is billed to customers on account.7. Withdrew $600 cash for personal use.8. Paid Chicago Tribune $500 of the amount due in transaction (4).9. Paid employees' salaries $2,500.10. Received $4,000 in cash from customers who have previously been billed in transac-tion (6).Instructions(a) Prepare a tabular analysis of the transactions using the following column headings:Cash, Accounts Receivable, Supplies, Equipment, Accounts Payable, Owner's Capital,Owner's Drawings, Revenues, and Expenses.(b) From an analysis of the owner's equity columns, compute the net income or net lossfor April. Find the value of x. Leave your answer in simplest radical form. Select the correct answer.Simplify the following expression.x^-2/3 x x^6/7A. B. C. D. How do I work this out? Someone explain fully please 16.) The population of Wolf County was 12,390 in 2000 and 13,090 in 2010. Assuming that population growth in this county is linear, find the following: b.) When will the population reach 21,000 people? c.) When did the first settlers arrive in Wolf County? In the measurement 0.342, which number is the estimated digit? The (_______________________________) Clause means that states must recognize the judgments, legislation, and public records of other states. 1.Interstate Commerce2.Privileges and Immunities3.Due Process4.Equal Protection5.Full Faith and Credit Which subatomic particle is correctly paired with its properties?A) Proton: positively charged, mass about equal to that of an electronB) Neutron: no electric charge, mass about equal to that of a protonC) Electron: negatively charged, mass about equal to a neutronD) Positron: negatively charged, mass about equal to that of a proton. What event determines when a chromatid becomes a chromosome. Questions1. An object travels 3 meters in 1.5 seconds. What is its velocity? 7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA wouldyou see on the electrophoresis gel?BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 33TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5 GIVING BRAINALIST IF CORRECT + LIKESIs the tense correct in the example ?Were vegan our trip right now.A.)Yes B.)No HELP ME NOW!Which is a benefit of dynamic stretching? *increases heart rate increases oxygen and blood flow in the body improves range of motion all of the above Thabo rounded the number to the nearest 5. His answer was 340. Write down 2 possible number for the actual number of marbles