Please help!!!!
Which statement about genes is NOT true?
A
All copies of every gene are always identical.
B
Each gene has a specific place on a chromosome.
с
Traits are passed from parent to offspring through genes.
D
A gene contains information about specific characteristics and traits.
Answer:
A ;)
Explanation:
On a pedigree chart, males are represented by a circle and females are represented by a square.
A True
B False
Answer:
B False
Explanation:
I hope this helps! Have a great day!
Answer:
False
Explanation:
Its the other way around
What kinds of hazards do volcanoes pose for people? O Ash and dust Destruction of land, homes, and cities , Poor air quality for breathing O All of the above
Answer:
All of the above
Explanation:
Volcanoes are very destructive, destroying homes and throwing ash all over the land and burning down many things like trees and forests with their magma
what physical changes did you experience when you were 13?
Answer:
i started getting more hair EVERYWHERE i mean everywhere. voice cracks started to come in. I realized stuff that i used to love i was drifting away from it. for ex. i used to like jake paul now i hate him. lol
HELP ASAP
1 The intestines breed both helpful and harmful microorganisms.
True
False
2 A child is born with many microbes in his or her body.
True
False
3 A child is usually born with all of microorganisms that live in the human mouth.
True
False
4 The intestines are a good breeding place for microbes.
True
False
5 Animals provide a means to test and understand various disease germs.
True
False
Answer:
1. True.
2. False.
3. False.
4. True.
5. True.
Explanation:
1. True: The intestines breed both helpful and harmful microorganisms. This relationship between the host and these microorganisms is called a symbiotic relationship.
2. False: A child is born with many microbes in his or her body. Basically, it has been established that there are no microbes in the womb of pregnant women (mothers) and as such babies are not exposed to any microbe until when they are born.
3. False: A child is usually born with all of microorganisms that live in the human mouth. This is false as well because the womb and placenta is essentially free of bacterias, fungi and other microbes.
4. True: The intestines are a good breeding place for microbes. This is completely true because of the regulated temperature and it mainly contains foods which the microorganisms live on.
5. True: Animals provide a means to test and understand various disease germs. Animals such as squirrels, rats, mice, frogs, monkeys are all used as specimens for testing and understanding various diseases and germs.
Which statement best explains the process of cellular respiration?"
A: Glucose and another product are formed when carbon dioxide and water are
combined.
B:Oxygen and another product are formed when carbon dioxide and water are combined
C: Bonds are broken within the carbon dioxide molecules, providing energy and releasing
oxygen
D: Bonds are broken within the glucose molecules, providing energy and releasing
carbon dioxide.
Answer:
The answer is D.
Explanation:
Cellular respiration requires glucose and oxygen to form carbon dioxide and water.
Equation:
Glucose + Oxygen → Carbon dioxide + Water
C6H12O6 + 6O2 → 6CO2 + 6H20
Put the following words in order from smallest to largest
structure according to the Organization of Organisms.
1. human cardiac muscle cells
2. human cardiovascular system
3. human heart
4. oxygen atom
5. human
6. human cardiac connective tissue
The oxygen atom, human cardiac muscle cells, human cardiac connective tissue, human heart, human cardiovascular system, and humans are the order of organization according to size from smallest to largest.
What is the organization system?
The human body has frequently been compared to a machine. Consider some everyday devices like drills and washing machines. Each component of a machine, which is made up of several elements and has a variety of functions, cooperates to carry out a single overall task.
In all these aspects, the human body is much like a machine. In fact, it could be the most amazing device ever created. The human machine is structured on a variety of levels, from the cell to the complete body. There is an increase in complexity with each level of organization.
Therefore, from smallest to largest, the level of organization is an oxygen atom, human cardiac muscle cells, human cardiac connective tissue, human heart, human cardiovascular system, and human.
Read more about organization levels, here
https://brainly.com/question/14874114
#SPJ2
Triglycerides are compounds created by combining a molecule of glycerol with three fatty
acids. Triglycerides are used to store large amount of energy and are classified as a form of
which biomolecule?
O proteins
nucleic acids
carbohydrates
lipids
Help quick
What happens to the sugars that are made during photosynthesis?
a. They move directly into an electron transport chain. b. They go back into the Calvin cycle. c. They can be used for cellular respiration. d. They make ATP by bonding together.
Answer:
C-They can be used for cellular respiration.
Explanation:
Answer:
C. they can be used for cellular respiration
Explanation:
C. they can be used for cellular respiration
Sam had a disease that weakened his heart so it could not pump properly. This heart problem
caused him to have low energy because his cells could not get the nutrients they needed.
Based on this information, Sam's disease primarily affected the functions of which two
systems?
1. skeletal system and digestive system
2. muscular system and cardiovascular system
3. integumentary system and muscular system
4. excretory system and cardiovascular system
Plz answer quick
Answer:
2. muscular system and cardiovascular system
Prompt:
Based on the TUVA activity, state a scientific explanation on the
main cause of global warming.
Claim (Please refer to number 2 on your handout):
Evidence (Please refer to table and questions 2 and 3 about the
table):
Reasoning (Please refer to the analysis questions from your
handout):
Answer:
Main causes of Global Warming
Global warming is an aspect of climate change, referring to the long-term rise of the planet's temperatures. It is caused by increased concentrations of greenhouse gases in the atmosphere, mainly from human activities such as burning fossil fuels, deforestation and farming.
Global warming occurs when carbon dioxide (CO2) and other air pollutants and greenhouse gases collect in the atmosphere and absorb sunlight and solar radiation that have bounced off the earth's surface.
Five Causes of Global Warming are:---
Greenhouse Gases Are the Main Reasons for Global WarmingVariations in the Sun's IntensityIndustrial ActivityAgricultural ActivityDeforestationThe chemical equation of photosynthesis includes 60, Which best describes this substance? O a solid used during photosynthesis a gas used during photosynthesis a liquid produced during photosynthesis a gas produced during photosynthesis
Answer:
a gas used during photosynthesi
Explanation:
The chemical equation of photosynthesis is 6CO2 + 6H2O=C6H12O6 + 6O2
O there is oxygen and it is a gas. This is because during photosynthesis, carbondioxide react with water in the presence of light energy and chlorophyll to produce glucose and oxygen. The oxygen produced is a gas and it is use during respiration of animals.
which part changes in the different nucleotides
Answer:
Explanation:
The phosphate group (PO4) is what differentiates a nucleotide from a nucleoside. This addition changes the nucleoside from a base to an acid. These phosphate groups are important, as they form phosphodiester bonds with the pentose sugars to create the sides of the DNA “ladder.
The sugar in DNA is deoxyribose. Deoxyribose differs from ribose (found in RNA) in that the #2 carbon lacks a hydroxyl group (hence the prefix “Deoxy”). Nucleotides in DNA contain four different nitrogenous bases: Thymine, Cytosine, Adenine, or Guanine.
What can harm biodiversity?
Answer:
Human Activities and Loss of Habitat.
Explanation:
Hope this helps! ^^
Answer:
idrk i just need to complete qeust, and i need a brilliantist...can i get 1
Explanation:
Small structures inside cells that perform specific functions are called:
ОА. АТР
B. Organelles
C. Plastids
D. Lipids
Answer:
B. Organelles
Explanation:
they are called
Answer:
organelles I believe, hope this helps
Elian is testing his hypothesis that the more ripe an orange is, the more Vitamin C
it contains. He takes four oranges of varying degrees of ripeness and squeezes
samples of juice from each one. He then measures the concentration of Vitamin
C in each sample of orange juice. He systematically adds a measured amount of
a chemical called a titrant into the orange juice, waiting for its color to change.
When its color changes, he knows that the amount of Vitamin C present in the
juice is equal to the amount of the titrant he has added, which he can
calculate.What does Elian think is the independent variable in this experiment?
A: orange ripeness
B: amount of titrant
C: color of the solution
D: amount of Vitamin C per orange
Answer:
A
Explanation:
A: orange ripeness
Use the following data to answer the questions that follow:
Cameroon TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT
Tsavo
TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAATCGCCTCCTCAAAT
Fannie Roberts TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Sabi Sands TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTGAAAT
Umfolozi TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Zimbabwe TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Zambia
TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Kalahari TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Botswana TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT
Etosha
TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT
5) What question can the data above help to answer? Write your question here:
cameroon: ughargjbendvnqergbe
tsavo:ergqirghrgjnqr;jg
fannie:ehrgbqwjgnwlgwe
sabi:ergnqwojnqwkgwr
umfolozi:rgnjbnldn;wdjnv
zimbabwe:qowehfsdjlfrgna
zambia:egn;wejncsdc
kalahari:hebrgjnaskdmc
botswana:uopwefanne;fj;qufu
etosha:el;krlnalr
hope thathelpedWhich statement describes an example of the control of gene expression?
A Three types of RNA are made in the nucleus during the process of transcription.
B New polypeptides are made using amino acids brought to ribosomes by tRNA
molecules.
C Certain coding segments of mRNA are assembled after non-coding segments are
removed.
D RNA polymerase matches RNA nucleotide bases to the DNA bases of the coding
strand.
Answer:
D
Explanation:
Two pure substances combine to make a new substance. The new substance cannot be
physically separated and has a different boiling point than each of the original substances.
This new substance can best be classified as
an atom
an element
a mixture
a compound
A virus causes an illness that includes the following symptoms: headaches, fever, and body aches. Symptoms usually occur two to seven days after infection by the virus. What type of reproductive cycle does this virus most likely have?
Answer:
Viruses like Influenza reproduce via the lysogenic cycle.
Explanation:
Viruses are pathogenic, disease-causing microorganisms. They reproduce and spread in a variety of ways, and their life cycle or lytic cycle influences the symptoms of their specific infections.
Influenza viruses, in particular, exploit receptors on the cell surface for entry into the cell. They reproduce by using the host cell's replication mechanism in the nucleus. They and use the host's cellular machinery in order to replicate.
This cycle usually lasts for 2-7 days, after which the virions bus from the host cell, incorporating parts of their lipid bilayers. The viral particles spread via infective particles or droplets from the lung tissue of their host.
which pH does the lipids need to be digested?
Answer:
Lipids need a pH between 4 and 5.5 to be digested, because this is the optimum pH for the lipase enzyme to act.
Explanation:
Lipids are organic macromolecules necessary for vital functions, derived from fats and oils consumed with food.
Lipids are digested in the stomach by the lipase enzyme produced in the pancreas. Lipase performs best at an acid pH, between 4 and 5.5, which is the pH required for lipids to be digested. A different pH slows down the effect of the enzyme, or inactivates it.
About ______ of the body’s blood supply is circulating through the dermis at any given time.
75%
2%
15%
25%
The percentage of the body’s blood supply that is circulating through the dermis at any given time is about: D. 25%
A blood refers to a red bodily fluid that is typically transported and circulated through the veins and arteries found in the body of living organisms such as human beings and eukaryotic animals.
Basically, the body’s blood comprises the following:
Red blood cells.White blood cells.Proteins.Platelets.Dermis can be defined as the inner layer of a skin which lies directly above the subcutaneous layer and beneath the epidermis layer.
Also, the dermis is considered to be the thickest layer of the skin and as such it only allows about 25 percent of the body’s blood supply to circulate through it at any given time.
For more information on blood: https://brainly.com/question/17058567
Please help me akshdakdhakdhskk
Answer:
nucleotide, dna, gene, chromosome
The endosymbiotic theory states that eukaryotes evolved from prokaryotes. Which statement is part of the endosymbiotic
Note about the question:
Statements are missing, and I failed to find the complete question. So here I give you some details about the theory that will help you to indetify the correct statement.
Answer and Explanation:
The endosymbiotic theory essentially states that some organelles of the eukaryotic cells, such as mitochondria and chloroplasts, were once free-living bacteria. Probably, these organisms must have been phagocytosed but not digested by another cell. On the contrary, these bacteria were able to adapt to their host in such a way that the two cells established a dependent relationship with each other.
It is speculated that chloroplasts derivate from cyanobacteria and that mitochondria derivate from rickettsias.
Cells would be beneficiated from this new bond, at the point that they could not survive by themselves anymore.
This theory is supported by a few characteristics of the chloroplasts and mitochondria that suggest that they once were a free cell. For example,
Both organelles present their genetic material. This DNI is independent of the cell´s DNA, is bi-catenary and circular, identical to the bacterial DNA, and very different from the one of the eukaryotic cells. These organelles do not divide by mitosis. Instead, they do it by binary fission and are capable of synthesizing their ribosomes and organelles. Both organelles present a double membrane, a characteristic that reinforces the idea of being phagocyted. The internal membrane looks identical to the bacteria membrane, while the external membrane looks like the eukaryotic one. In fact, in this internal membrane are placed the energy centers, exactly as it occurs in bacterias membrane. Finally, the sizes of the organelles are similar to the size of some procaryotes.Brainliest to who types this up correctly!!!
Answer:
The Y chromosome is an accurate indicator of a person's external sex organs.
Explanation:
Since females have two X chromosomes while males have one X and one Y chromosome, if you are aware of the presence of a Y chromosome you can safely assume that a person is a male. Therefore, you can assume what external sex organs a male has.
The Y-chromosome is an accurate indicator of a person's external gender organ. I agree with this statement.
What is Gender-determination?It is the process of determining the gender of a particular organism on the basis of chromosomal numbers or its functions.
As we all know that a human female has a pair of X-chromosomes (homomorphic), while a human male has an X and a Y-chromosome (heteromorphic). Y-chromosome is a gender-determining chromosome in humans. A person having an XY set of chromosomes produces a hormone called testosterone secreted by the testes, while an individual having a XX chromosome produces a hormone called estrogen secreted by the ovary. And the external gender organs are developed as the chromosomes and hormone influences for the same.
Therefore, the Y-chromosome is an accurate indicator of a person's external gender organ.
To learn more about Gender-determination, refer to the link:
https://brainly.com/question/2600679
Is this statement true or false? Voluntary muscles move when you want them to, while involuntary muscles move automatically. I don't know the answer :(
Which best describes a dichotomous key?
Each step has two choices.
Each step can have any number of choices.
Each step describes two possible inferences.
Each step is based on genetic traits.
Answer:
Each step has two choices
Explanation:
took the test just now (2023)
can mutations be inherited by offspring
Answer:
Yes
Explanation:
Are Eukaryotic cells complex or simple?
Answer:
Complex because it has a lot of membrane bound organelles
I think so. They have their own energy factories (mitochondria) and their DNA is linear and found in the nucleus.
The table lists general categories of blood disorders. Some information is missing, as shown by the letters X, Y, and Z.
Type of disorder
Reduced platelet counts
Categories of Blood Disorders
Primary impact on the body
Deprives cells of oxygen
Reduced WBC counts
Which list correctly completes the table in the order X, Y, Z?
O RBC malfunction, internal or external bleeding, reduced ability to fight infection
O reduced ability to fight infection, RBC malfunction, internal or external bleeding
O internal or external bleeding, RBC malfunction, reduced ability to fight infection
O internal or external bleeding, reduced ability to fight infection, RBC malfunetion
Answer:
C. internal or external bleeding, RBC malfunction, reduced ability to fight infection
Explanation:
WBC deals with the ability to fight off infection, RBC deals with delivering oxygen to cells, and platelets create blood clots for wounds, so if they weren't doing their jobs, you have have bleeding.
Hope this helps
Answer:C
Explanation:
