Connotation does not refer to:
A. the meaning of a word that changes depending on someone's
experiences.
B. the meaning of a word that changes depending on someone's
culture.
C. the dictionary definition of a word.
O D. the feelings and emotions attached to a word.

Answers

Answer 1
i think it’s D!!!!!!
Answer 2

Connotation does not refer to the dictionary definition of a word. Option C is correct.



Connotation refers to the feelings and emotions that are associated with a word (D). It goes beyond the literal or denotative meaning of a word and includes the subjective or cultural meanings that people attribute to it.

For example, the word "home" may have a positive connotation for some people, representing a place of comfort and security. However, for others who have had negative experiences at home, it may have a negative connotation.

Connotation can also vary depending on someone's experiences (A) and culture (B). Different individuals or groups may interpret words differently based on their personal or cultural backgrounds.

To summarize, connotation is about the emotional or cultural associations that people have with a word, not the dictionary definition.

To know more about dictionary:

https://brainly.com/question/1199071

#SPJ4


Related Questions

1. The following is an example of new media ; except for:

A. Smart phones
B. Radio
C. Wearable technology
D. Web browser

2.The following are correct about new media ;except for:

A. Media experience is limited.
B. Experience of media is interactive.
C. Integrates all the aspects of the old media.
D. Audiences are more involved and can send feedback simultaneously.

Need Help!! ​

Answers

Answer:

1.) Radio

2.) A

Explanation:

coz you that better..........

Which sentence correctly uses an adverbial phrase?
A. Although he was tired, John hurried.
B. John, a really fast runner hurried.
C. John hurried quickly.
D. John hurried over the hill.

Answers

Answer:

a. Although he was tired, John hurried.

Answer:

correct answer would be D.

Explanation:

Directions: Write 3 paragraphs on the topic below: Follow all rules of spelling,
grammar and punctuation.
{only 3 paragraphs}

TOPIC: Imagine you saw your best friend cheating on a test. Write a story about what
you would do.​

Answers

Answer and Explanation:

In today's class I witnessed a scene that shocked me, because I never expected it to happen. My friend, who I've known since I was a little child of a few years old, arrived at school with a strange appearance, he had dark circles and a tired face, he didn't even smile at me when I nodded and spent all the time quiet and talking a lot little. But the most surprising thing about that day was that during our test, I could see mine that my friend, who was always very studious, was cheating on the test.

I was surprised because I always heard him being completely against students who do this, stating that it is useless to pass a test without having learned the subject, cheating as if that would be beneficial. To my surprise, I tried to talk to him after the test and find out what was going on, but he disappeared as soon as he handed the test over to the professor. I was thinking about what I can do and I am lying in my bed, imagining a thousand scenarios about what my attitude towards this should be.

I would never pass on what my friend did to the teacher, because I don't think it is right to harm a person at that level. For that reason, after thinking a lot, I called my friend and told him about what I saw, he was very nervous, but I calmed him down saying that I would not say this to anyone, but that I needed to know what was happening to him and how could I help him not cheat in the next tests. I believe that I made the right decision and that I will have good results from that.

Which detail from "Undercover Farmer” best shows that the narrator’s activism on behalf of farm animals changed practices in the community?

Answers

Answer:

B: Three weeks later, two businesses had signed on, and two more said they’d think about it.

Explanation:

on edge2021! hope this helps!

Answer:

B: Three weeks later, two businesses had signed on, and two more said they’d think about it.

Explanation:

on edge2021 just did it


Which of these is an opinion?
A
Douglas Miles uses his Apache Agency Skate Shop to organize skateboarding
competitions and concerts for skaters.
B
The Stronghold Society built skateparks in both Manderson and Pine Ridge as part of
its mission to inspire Lakota youth.
C
The painted skateboard decks created by Douglas Miles are works of art that add style
to skateboarding.
D
Some of the visitors to the Pine Ridge Reservation skateparks might get to watch
skaters do pro skateboarding tricks.

Answers

Answer:

C. The painted skateboard decks created by Douglas Miles are works of art that add style to skateboarding.

Explanation:

This statement is an opinion. "Are works of art that add style" is not a fact, but a personal opinion, since some may disagree and think otherwise.

Read the excerpt from Beowulf. Which of Heorot's qualities do these lines deict?

Answers

Answer: The lines in this excerpt from Beowulf depict Heorot's qualities of elegance. ... Therefore, Heorot was extravagant and elegant.

Explanation:

Female geese lay their eggs only in the spring and may lay several eggs until they begin to incubate them. This collection of eggs is referred to as a clutch. First, the female goose will find a location where she has a good view of her surroundings and builds her nest. Once she has her clutch filled, she will sit on the eggs to incubate them; this step may take anywhere from 28 to 35 days. The female goose will leave her nest for a few minutes to feed and water, and while she is gone from the nest, the gander will take over the incubation. Ganders are very protective of both the female and the eggs, making sure predators stay away.
Which title is best for the passage?
A. Geese eggs
B. Incubating eggs
C.Egg clutch
D.Goose and Gander

Answers

Answer:

B

Explanation:

Which sentence uses parallel structure correctly?

A) We plan on playing basketball and then to see a movie.

B) She is not only a good cook but also she figure skates well.

C) At the last performance, we were all feeling sad, relieved, and being somewhat nervous.

D) Len's favorite pastimes are listening to music, going to baseball games, and hanging out with his friends.

Answers

Answer:

D) Len's favorite pastimes are listening to music, going to baseball games, and hanging out with his friends.

Explanation:

Parallel structure/parallelism in writing is the use of words in a way that is not repetitive and uses the same grammatical pattern to make the sentence easy to understand without ambiguity.

Therefore, the sentence that correctly uses parallelism is option D.

How has the LatinX immigration experience changed over the last 100 years?

Answers

Answer:

Immigration in the Early 1900s. After the depression of the 1890s, immigration jumped from a low of 3.5 million in that decade to a high of 9 million in the first decade of the new century. Immigrants from Northern and Western Europe continued coming as they had for three centuries, but in decreasing numbers.

Explanation:

Hope this Helps (✿◡‿◡)

Plz help me I’m confused

Answers

Answer:

1. ready, prepared

2. milion

Explanation:

1. ready and prepared are synonyms, with the same meaning.

2. "milion" is supposed to be million.

Answer:

Number 1  = ready, prepared

Number 2 = Million

Plzz helpppp 15+pts and brainliest!!!!!!!!!

What is the the meaning behind the short story I Came, I Saw, I Shopped? (All that glitters)

Answers

Answer:

"I came, I saw, I shopped" is a short story about shopping spree nature of Americans. I think.

Explanation:

Here is a message to brighten your day if you need it.
"No matter how long you have traveled in the wrong direction, you can always turn around." Have a great day

Answers

Answer:

nice thx u too

Explanation:

Answer: Aw, also thank you for the free points hehe ^-^.

Explanation:

The explorers led the first
expedition
in the new world.
pioneer
B
visitor
Voyage
D supplies

Answers

Answer: a.in the new world.

pioneer

Explanation:

WILL MARK BRAINIEST

Which line explains the author's point about responsibility in the second paragraph?
We are bound, because of our greatness, to recognize the rights of others.
C We are strong enough to pursue acts of insolent aggression against others.
O We have justice and righteousness on our side and so will always be just.
We have become, as ag
Other

Answers

Answer:We are strong enough to pursue acts of insolent aggression against others.

Explanation:I believe it is this line.

A student plans to use the details in this passage as part of a research
paper. What additional information is needed to properly credit the
passage in the list of sources used?
A) full publication information
B)
the number of pages in the book
C) the name of the original source
D) the birth and death dates of Frederick Douglass

Answers

The answer is C the name of original sources.

Answer:

A: Full publication information

Explanation:

hope it helped

What are the different settings that Gilbert is thinking of

Answers

Answer:

Explanation:

whta  be more specific

Analyzing Magazine Article Citation
Which magazine article citation is written correctly in MLA style?

“You’ve Come a Long Way, Wes.” David Brewster. Seattle. Sept. 1970: 34-45. Print.
You’ve Come a Long Way, Wes. Brewster, David. Seattle. Sept. 1970: 34-45. Print.
Brewster, David. “You’ve Come a Long Way, Wes.” Seattle. Sept. 1970: 34-45. Print.
Brewster, David. “You’ve Come a Long Way, Wes.” Seattle. Sept. 1970: 34-45. Print.

Answers

Answer:

It is the 3rd one

BTW you put the same thing as the 3rd one for the 4th one

Explanation:

Answer:

3rd

Explanation:

edge 2023

Which of these techniques help create the rhythm in this poem

Answers

You didn't give the options for techniques, but I will explain to you what rhythm in a poem is.

Simply put, rhythm can be defined as the beat and velocity of a poem. Rhythm is created by a continuous pattern of 'stressed and unstressed' syllables in a line or verse of your poem. Rhythm can help to strengthen the application of words and ideas in a poem.

PLEASE HELP !!!! :(((
‼️I WILL MARK BRAINLIEST‼️
10 POINTS


Which part of the sentence contains an infinitive?

When the doorbell rang, the puppy ran to the door to see what new friend he might find on the other side.

A. puppy ran to the door

B. on the other side

C. When the doorbell rang

D. to see what new friend

Answers

Answer:

I'm not completely sure but I think it would probably be A

Will give brainlist

Please help

Answers

Answer:

Here ya go:):)

Explanation:

#1 "Social media has become an irremovable part of this world."

#2 "Online learning could be the future for learning of all generations."

#3 "We could try to live without technology, but living our day to day lives would become much harder."

ANSWER:

Social media has both positive and negative impacts on society even though it just used for communicating.

If social media goes away, cyber bullying will increase.

Hope this works ;)

which lines in this excerpt from act 1 scene v11 of macbeth imply that macbeth considered duncan a good man​

Answers

Answer:

Besides, this Duncan

Hath borne his faculties so meek, hath been

So clear in his great office, that his virtues

Will plead like angels, trumpet-tongued, against

Explanation:

William Shakespeare's "Macbeth" revolves around the story of how Macbeth propels himself to be the King of Scotland. But despite being king, he would also bring about his downfall in the end.

Act I scene vii of the play reveals Macbeth's reluctance, at some point, about killing Duncan. But if he did not do that, then the throne will not be his. So, pressurized by his wife, he did the deed of killing Duncan and putting the blame on the chamberlains.

But, the opening scene shows Macbeth revealing his true opinion of the King. He admits "Besides, this Duncan

Hath borne his faculties so meek, hath been

So clear in his great office, that his virtues

Will plead like angels, trumpet-tongued, against".

These lines reveal how Macbeth considered Duncan to be a good man, whose virtues will speak for him even in the afterlife.


Who does Odysseus see in the underworld?
a. Laertes
b. Polyphemus
c. Anticleia
d Antinous

Answers

Answer:

C

Explanation:

parapharse: The fleet in view, he twang’d his deadly bow,
And hissing fly the feather’d fates below.

Answers

im sorry but I need a definition of fleet first

Why studying is better than sports? Essay please help

Answers

Because you learn things that you can use in your every day life and was sports you can’t use those as much as you can use education

PLZ HELP!! What scholarly behaviors support learning? (Will give brainliest!) 4-5 sentences

Answers

Answer:

Hello! I found your other question and answered on there, I'm answering again  the same thing here: The following behaviors can help learning. First is you have to be focused. In order to focus, you have to remove any possible distractions (e.g. phones, food, etc) and listen to the speaker. Getting enough sleep also helps with focusing. The second is being respectful. This also includes listening to the speaker and raising your hand before you talk. If you are respectful, others will also treat you with respect and it will create a good learning environment.

Hope this helped!

They already answered your question

Answer right I’ll mark brainliest And give 20 points


Which revision corrects the inappropriate shift in verb mood?
Building a homemade birdfeeder is a fun craft that brings
wildlife to your yard. First, it would be best to choose a
design. If you choose to make a wooden birdfeeder, you
will need more tools. If you use a plastic bottle, you can
recycle materials from around your home. Ask an adult to
help you with any cutting. Be sure to find out what type of
birds live in your area and buy the right kind of seed.
A. First, choose a design.
B. First, would you choose a design.
C. First, you will want to have chosen a design.
D. First, what design are you choosing?

Answers

Answer:

A

Explanation:

Answer:

A. First, choose a design.

Explanation:

I took the test and got it right.

Which best revises sentence 3 to make it more precise? had so many grand plans in my head for the money I would soon be making, and I hurried to get ready as quickly as I could

Answers

There were so many amazing plans going through my head for the for the large amounts of money I would soon be making I thought, as I ran as quickly as I could.

Why is taking notes beneficial to a student?

Answers

Answer:

because you can look back at them and also you them to study

Explanation:

How does Congress potentially affect a presidential election?
A: Congress moves the date of the inauguration closer to the election date.
B: Congress picks a president if there are problems with counting the votes.

C: Congress selects a new vice president to take the place of the president.
D: Congress determines the end of the president's term after an election loss.

Answers

Answer:

While Members of Congress are expressly forbidden from being electors, the Constitution requires the House and Senate to count the Electoral College's ballots, and in the event of a tie, to select the President and Vice President, respectively.

Explanation:

What are some similes and metaphors from "The Polar Express"?

Answers

Examples of metaphors from the Polar Express:
1.The train wrapped in a apron of steam, 2.Lights appeared in the distance. They looked like the lights of an ocean liner sailing on a frozen sea.
3. crossed a barren desert of ice.
Examples of similes from the Polar Express:
1. candies with nougat centers as white as snow.
2. hot cocoa as thick and rich as melted chocolate bars.
3. rolling over peaks and through valleys like a car on a roller coaster.

Examples of metaphors from the Polar Express:

1.The train wrapped in a apron of steam, 2. Lights appeared in the distance. They looked like the lights of an ocean liner sailing on a frozen sea.3. crossed a barren desert of ice.

Examples of similes from the Polar Express:

1. candies with nougat centers as white as snow.2. hot cocoa as thick and rich as melted chocolate bars.3. rolling over peaks and through valleys like a car on a roller coaster.

What is metaphors?

Metaphors are literary devices that use direct comparisons of two items to suggest that the first has a particular trait. To show or explain something by comparing it to another item, metaphors are frequently employed in communication. By directly comparing two distinct things, metaphors are utilized to make comparisons.

According to the metaphors and the similes are the Polar Express on the

1. The locomotive was surrounded in a steam apron. 2. Lights came in the distance. They appeared to be the lights of a steamship traveling on a frozen sea.3. traversed an icy desert.

The example of the similes are:

1. snow-white nougat cores in candies.2. steaming cocoa as thick and rich as molten chocolate bars.3. swerving over peaks and into troughs like a car on a rollercoaster ride.

Learn more about on metaphors, here:

https://brainly.com/question/27250460

#SPJ5

Other Questions
When the dry and wet bulb temperatures are far apart. the humidity is high.TrueFalse The angle measurements in the diagram are represented by the following expressions.BSolve for x and then find the measure of Given the following list of numbers, find the mean. 5,6,12,2,5,12,14 here is the CORRECT answer to all you guys answering with semiarid Universal Container wants to understand all of the configuration changes that have been made over the last 6 months. Which tool should an Administrator use to get this information 1. While cell phones provide Freedom and mobility,they can also become a leash, compelling user's to answer them anywhere and anytime How many years will it take for $20,000 to earn $7,000 in interest if placed in an account that earns 2.09% simple interest? I NEED HELP ASAP PLEASERead the poem.Ozymandiasby Percy Bysshe ShelleyI met a traveller from an antique land,Who saidTwo vast and trunkless legs of stoneStand in the desert. . . . Near them, on the sand,Half sunk a shattered visage lies, whose frown,And wrinkled lip, and sneer of cold command,Tell that its sculptor well those passions readWhich yet survive, stamped on these lifeless things,The hand that mocked them, and the heart that fed;And on the pedestal, these words appear:My name is Ozymandias, King of Kings;Look on my Works, ye Mighty, and despair!Nothing beside remains. Round the decayOf that colossal Wreck, boundless and bareThe lone and level sands stretch far away.What is the structure of "Ozymandias"?limericksonnetfree versehaiku Which type of cell are found in the leaves of a tree?O eukaryotic animalO chloroplasticO prokaryoticO eukaryotic plant together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?. Lots of points please help TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids: Given=42and=16, find DG. (help fast please)A. 38.8B.26.4C.44.9D.13.6 Is this statement true or false?Eleanor Roosevelt fought for the rights of the underdog for all those who were persecuted or treated unfairly including women, minorities, the poor, and children. Internal anatomy of the earthworm a. The mouth leads to what structure? b. After the esophagus, food passes through what three structures? c. Undigested particles are eliminated through the what? d. What is the purpose of the nephridium? e. What is the purpose of the seminal vesicles? f. Where are the seminal receptacles located? (repost) Help Please I will Give brainliest If Correct!! Write the equation of the line passing through the points (-7,4) and (7,2). Mia is a songwriter who collects royalties on her songs whenever they are played in a commercial or a movie. Mia will earn $50 every time one of her songs is played in a commercial and she will earn $120 every time one of her songs is played in a movie. How much would Mia earn if his songs were played in 5 commercials and 3 movies? How much would Mia earn if his songs were played in cc commercials and mm movies? Which statement best describes subduction?