Answer: Answer below, hope this helps! :D
Explanation:
A conjugated protein is a protein that functions in interaction with other (non-polypeptide) chemical groups attached by covalent bonding or weak interactions. ... The non-amino part of a conjugated protein is usually called its prosthetic group. Most prosthetic groups are formed from vitamins. Hemoglobin is a protein having a globular structure. Based on its structural properties, hemoglobin can be divided into two parts; a protein part and a heme group. The structure of the protein part can be studied at four levels; primary structure, secondary structure, tertiary structure, and quaternary structure.
Which type of cell are found in the leaves of a tree?
O eukaryotic animal
O chloroplastic
O prokaryotic
O eukaryotic plant
Answer:
Palisade parenchyma cells
Explanation:
Palisade parenchyma cells are elogated cells located in many leaves just below the epidermal tissue. Spongy mesophyll cells occur below the one or two layers of palisade cells. Ray parenchyma cells occur in wood rays, the structures that transport materials laterally within a woody stem.
Answer:
eukaryotic plant
Explanation:Unit 2 Test: Cells
Shenya Jones, a 34-year-old female, arrives at the office with a swelling and a red pustule on her face. She states the problem started two days ago as a small pimple near her nose. It became irritated then became extremely swollen and painful overnight. This morning there was yellow drainage noted at the site and the swelling has increased. The area of drainage is approximately 1 cm in diameter. The upper lip, side of the face, and nose are all swollen. She rates the pain in her face as a 7 out of 10. The physician thinks the condition may be impetigo or methicillin-resistant Staphylococcus aureus (MRSA), a type of skin infection that is resistant to the common antibiotics used to treat it. A wound culture is obtained.
1. Considering the structures of the skin, what most likely was the cause of the original pimple on this patient's skin?
2. How could Shenya have prevented this skin infection?
Can someone help me please i will pay i have to do this by 12am today no later than that
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
3. How does changing the number of neutrons affect an atom?
Answer:
The change of number of neutrons does not affect the charge of the atom. All it will affect is your average atomic mass which is the sum of protons and neutrons.
Explanation: Hope this can help! ^^
Answer:
It will change the isotopes.
The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference
Answer:
The coefficient of interference, I, is 0.1 (10% expressed as a percent)
Explanation:
Available data:
genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.The coefficient of interference, I, is complementary with CC.
I = 1 - CC
To calculate the coefficient of coincidence, CC, we must use the next formula:
CC= observed double recombinant frequency/expected double recombinant frequency
Note:
observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.By knowing the positions of genes, we can estimate the distances in MU between them per region.
The distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MUNow that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.
recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:
EDRF = recombination frequency in region I x recombination frequency in region II.
EDRF = 0.13 x 0.06 = 0.0078
Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:
ODRF = number of double crossovers / total number of individuals
ODRF = 7/1000 = 0.007
Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.
CC = ODRF/EDRF
CC = 0.007 / 0.0078
CC = 0.9
And by knowing the CC we can also get the coefficient of interference, I.
I = 1 - CC
I = 1 - 0.9
I = 0.1 = 10% (expressed as a percent)
Help me :(( please. It’s due soon
Answer:
I would guess B or C
Explanation:
I hope this helps
When equipment malfunctions, a(n) _____ needs to be initiated.
A) Notification
B) Paper Work
C) Alarm
D) Work Order
Answer: Alarm
Explanation:
When equipment malfunctions, an alarm should be initiated to bring the malfunction to the attention of the relevant personnel.
This will ensure that whatever adverse effects the malfunction could have caused is mitigated and the machine can be attended to on time to prevent further damage.
4. Watson and Crick made a successful model of DNA based on
Rosalind Franklin's X-ray studies. This indicated that
DNA was
A. a triple helix with intertwined bases.
B. a double helix with bases outside the helix.
a. a double helix with bases inside the helix.
D. a single linear molecule of bases held together by
sugar-phosphate bonds.
Answer:
The right answer is the third statement.
--> A double helix with bases inside the helix.
This indicated that DNA was a double helix, with bases inside the helix. The correct option is c.
What is Watson and Crick's DNA model?Watson and Crick theorized that DNA is a double helix made up of two long helical strands twisted together.
In "Genetic Implications," Watson and Crick postulate that the replication of deoxyribonucleic acid, or DNA, may have a structural foundation. Scientists had just recently concluded that DNA contained genes, which were known to contain information that dictated an organism's identity when Watson and Crick proposed their theory of DNA replication.
In their model, each DNA strand was made up of discrete elements called bases, and the bases on one DNA strand matched the bases on the other.
Therefore, the correct option is c. a double helix with bases inside the helix.
To learn more about the DNA model, refer to the link:
https://brainly.com/question/5077600
#SPJ2
Question 9 of 10
Which process is a form of mechanical weathering?
Explanation:
abrasion, pressure release, thermal expansion and contraction and crystal growth.
O research existing data on accidents involving cars
communicate the results by telling everyone about the prototype
Question 3 (1 point)
There is a set number of times you should go through the engineering design process
- if your design isn't working by the 3rd time through, it's time to just quit and give
up.
True
False
To
Answer:
false
Explanation:
you fix your design to make it work that is what being is all about if it doesn't work you don't give up you figure out what is wrong and fix it.
All energy comes from the sun. In 2-3 sentences, explain how it is transferred from one organism to another.
Answer:
When the sun rays come down into the atmosphere and the plants on the ground use photosynthesis to reproduce and eat. If an animal, for example, a bunny, eats grass the energy will be transferred to the bunny. If a fox eats the bunny, the energy transfers to the fox. the amount of energy will be reduced each time something is eaten because it keeps being consumed over and over.
Explanation:
Please select the word from the list that best fits the definition
Is half the size of Earh, has two moons, and has an atmosphere of mostly carbon dioxide
Mercury
Earth
Mars
Venus
Answer:
The first person is correct, the answer is Mars.
Explanation:
_______$$__$_______________
_______$___$$______________
_______$___$$______________
_______$$___$$_____________
________$____$$____________
________$$____$$$__________
_________$$_____$$_________
_________$$______$$________
__________$_______$$_______
____$$$$$$$________$$______
__$$$_______________$$$$$$
_$$____$$$$____________$$$
_$___$$$__$$$____________$$
_$$________$$$____________$
__$$____$$$$$$____________$
__$$$$$$$____$$___________$
__$$_______$$$$___________$
___$$$$$$$$$__$$_________$$
____$________$$$$_____$$$$
____$$____$$$$$$____$$$$$$
_____$$$$$$____$$__$$
_______$_____$$$_$$$
________$$$$$$$$$$
A male and a female are both heterozygous for a particular trait. Which of the following represents the expected ratio of dominant to recessive phenotypes in the offspring?
The given question is incomplete as it lack the options, however, answer can be given by the provided information.
Answer:
The correct answer is - 3:1 ratio.
Explanation:
In the question it is given that both male and female both are heterozygous for the trait, let assume dominant allele A and recessive allele a so the the gene for the both male and female is Aa.
Punnett square for the cross between both:
gametes: A, a and A, a.
A a
A AA Aa
a Aa aa
here two out of four are heterozygous dominant and one is dominant and one is recessive.
thus, 3 out of 4 are dominant and one out 4 are recessive.
thus, the answer is 3:1 ratio
Answer:
For the 4th time I need more points and its C
Explanation:
Choose all the right answers. Which items are common features of most mammals? produce milk come in all sizes fertilized egg develops inside the body have fins eggs laid outside of body have scales some mammals live in water all have hair or fur
Answer: Some mammals live in water all have hair or fur.
Explanation:
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
Which type of wave forms at the boundary between air and water in the open
ocean?
A. Surface
B. Longitudinal
C. Electromagnetic
D. Transverse
Answer:surface
Explanation:
Just believe me miss gorl
Answer:
surface waves form at the boundary where air and water meet in open ocean.
Explanation:
Just did the quiz.
NEED HELPP ASAP
Which of these is the best explanation for why the rock on the ocean floor and the rock on the continent are
NOT the same age?
There has been a lot of erosion on the continent and the older rock has been washed away.
There has been a lot of erosion on the ocean floor and the older rock has washed away.
Due to the movement of the plates, the rocks that make up the ocean floor are pulled inside the earth
more often and are much younger.
Answer:The continental crust is less dense so the oceanic crust subducts back to the mantle. This process explains why the younger rocks are found on the ocean floor. 24.
Explanation:
Neurons are either classified by their structural differences or their ? differences.
Which statement best
summarizes agricultural technology
over time?
A. Agricultural technology has
continually advanced over time, with
significant leaps forward during the
Agricultural Revolution and the Green
Revolution.
B. Agricultural technology
advanced quickly during the
Agricultural Revolution and the Green
Revolution but hasn't advanced since.
C. Agricultural technology didn't
advance before the Green Revolution.
D. Agricultural technology didn't
advance before the Agricultural
Revolution.
Agricultural technology has evolved over time, with significant leaps during the agricultural and green revolutions.
Agricultural revolutionAgriculture has been one of the sustainers (along with hunting) of early men and as such, has seen gradual development with time. Man has always been looking for better ways to do things in order to achieve outcomes.
With the era of the agricultural revolution, there was a huge transition of humans from the primitive lifestyle of hunting and fruit gatherings to that of agricultural settlements. Better ways to carry out crop production started receiving huge attention. from there, hand-made agricultural equipment started surfacing.
The green revolution has agriculture receiving utmost attention in terms of technological innovations. Farm machinery, agrochemicals, etc, started coming up with the result being a massive increase in crop production and general outputs.
More on agricultural revolutions can be found here: https://brainly.com/question/14121608
#SPJ2
What are the possible benefits of hybridization?
Answer:
Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.
Which of the following environmental parameters would be important to monitor in order to ensure sustainable logging?
A. The number of trees cut down versus number trees burned
B. The number of new trees planted to replace those removed
C. The number of trees needed to increase soil fertilization
D. The number of trees removed within a single species
Answer:
B. The number of new trees planted to replace those removed
Explanation:
Because to ensure that logging is sustainable, they have to sustain a certain ratio of trees cut down, to trees planted. D. The muber of trees removed within a single species could be right, but I think B is more right.
If you get this wrong you can blame it on me.
Answer:
The number of new trees planted to replace those removed
Explanation:
how is cancer cell division different from regular cell division
What are the three blood types? Explain how there could be an AB blood type.
Answer:
AB
O
A
B
the AB blood type is created (mostly) by someone with A blood type making a baby with someone with B blood.
Explanation:
The human blood group is classified into four major classes which are A, B, AB, and O. This is possible due to multiple allelism and codominance which are found in the alleles A and B.
What is blood typing?A blood type is the classification of blood into different groups, based on the presence or absence of antibodies and inherited antigenic substances on the surface of the red blood cells which are present in the blood. These antigens may be proteins, carbohydrates, glycoproteins, or the glycolipids, depending up on the blood group system.
In humans, the blood typing is of four types that is A, B, AB, and O. This is because, the blood typing is an example of multiple allelism and codominance. A and B alleles are codominant and O is recessive.
Learn more about Blood typing here:
https://brainly.com/question/256625
#SPJ2
Which two structures are found at the outside of the cell?
Answer:
All cells share common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell.
What is the main purpose of the light reactions?
Answer:
The overall purpose of the light-dependent reactions is to convert light energy into chemical energy. This chemical energy will be used by the Calvin cycle to fuel the assembly of sugar molecules.
To create ATP and NADPH to be used in the calvin cycle.
Explanation:
Hoped I helped please mark me brainliest!!
blanced diet must contain enough energy to meet the body's needs what else must it contain
Answer:
Water
Explanation:
Answer:
A balanced diet should contain many good Factors and they are -It should be very healthy it should be lightit needs to be nutritional The diet should not make the person fatIt should provide better sleep It should keep away the diseases Hope u like my answerpleaseee help ASAPPP
why does food get cold but drinks get hot
Answer:
it might be because of the room temperature.
Explanation:
since drinks are colder than the room temperature they will get warmer to be the same as the room temperature and because food is hotter than room temperature it gets colder to be the same as the room temperature. dont quote me on that just a guess
4.
What is the importance of biodiversity to humans and to ecosystems?
Answer:
Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.
Explanation:
looked it up
On a map, the continents have shapes that almost fit together like pieces of a jigsaw puzzle. How does modern science explain this fit of the matching shapes in terms of processes inside Earth?