Answer:c
Explanation:
Swag
Which cells have the most potential for therapy and can become anything?
Answer:
Stem cells have the ability to build every tissue in the human body, hence have great potential for future therapeutic uses in tissue regeneration and repair. In order for cells to fall under the definition of “stem cells,” they must display two essential characteristics.
Explanation:
what are the sugar-making structures in plant cells?
Answer:
Chloroplasts
Explanation:
they make sugar during photosynthesis.
Plants absorb water and nutrients from the soil into their roots. The water and nutrients are then transported to the leaves where they are used, along with energy from the Sun and carbon dioxide from the air, to make food for the plant. Which of the following parts is responsible for moving the water and nutrients from the roots to the leaves?
Answer:
Xylem cells
Explanation:
Answer: Xylem
Explanation:
40 POINTS PLS HELP..... PLS
18=0.125 . Which calculation is NOT a way to find 58?
Answer: the last one 1-0.125 doesn't equal 5/8, 5/8=0.0625 I believe the last one is the correct answer
Explanation:
1. Balance the chemical reaction of water
(Added photo)if you can help please do I would really appreciate it!
Explanation:
hers done..........
......
Which system transports carbon dioxide away from cells?
Answer:
The circulatory system also removes carbon dioxide and waste from cells
A hiker finds a smooth, rounded pebble along the shore of a stream that is flowing down from a mountain.
Which of these most likely caused the pebble to have this appearance?
A,b,c or d !????
PLS I NEED HELP
Answer: B
Explanation: Transport of pebbles in a stream causes them to collide and rub against one another and the stream bed, and the resulting abrasion produces the familiar smooth and rounded shape of river rocks.
"Explain what accounts for such a large amount of genetic variation within the human population?"
Answer:
humans are adapted to a wide range of environments, and genetic variation leads to phenotypic variation
Explanation:
It has been shown that the average genetic variation between human individuals is about 0.1% (i.e., one base pair out of every 1,0000 are different between any two individuals). This value seems low, but it is huge when we consider that the current estimate for the world population is 7,800,000,000 people. The phenotype is the result of the interaction between genotype and environment. Genetic variation is the raw material that enables some individuals to adapt to different environments. As species, humans have a high genetic diversity in order to develop a wide range of phenotypes well adapted to different environmental conditions.
I need help with this question. 10+ points and Brainliest for best answer!
Relative dating and absolute dating are two different methods for finding the age of a rock. Name one advantage of each method and one disadvantage of each.
Please help! This is due in two hours.
Answer: The full explanation below.
Explanation: The advantage of Relative dating is it can tell if a rock is older or younger that a certain object where the age is also not certain making it easier to tell when the other object was from, however it dose not give an exact age of the rock. Absolute dating is different because it gives you the exact age of the rock, but does not aid in find the age of any artifacts that can be found around it. Hope this helps! :D
Absolute dating establishes the exact age of a historical relic, whereas relative dating determines the order of age of several samples. Absolute dating is therefore a quantitative measurement, whereas relative dating is a qualitative measurement.
What is dating?To date ancient events, geologists commonly use radiometric dating methods, which are based on the natural radioactive decay of certain elements such as potassium and carbon.
Relative dating is used to order geological events and the rocks they leave behind. The limitation of relative dating of fossils is that it does not provide the absolute age of the preserved fossils.
Absolute dating methods take physical properties of an object and use them to calculate its age.
Despite the fact that scientists exercise extreme caution when dating objects, recent studies show that they still make mistakes.
Because of incorrect setup, the dates used with this method are incorrect. The dates may not be consistent over long periods of time.
Thus, above mentioned are some advantages as well as disadvantages of two types of radiometric dating.
For more details regarding radiometric dating, visit:
https://brainly.com/question/14799339
#SPJ2
Mitosis is a type of cell division that occurs
I. to make more cells so organisms can grow.
II. so organisms can replace old or damaged cells.
III. when organisms make sex cells for reproduction.
IV. only during fetal stages of development.
Answer Choices:
A. I, II, and III only
B. II, III, and IV only
C. I and II only
D. I and IV only ....
Answer:
The correct option is A.
1, 11 and 111 only.
Explanation:
This is because mitosis is a type of cell division in which a single parent cell divide into daughter cells that are genetically identical to the parent cell or have the same number of chromosomes with the parent. This type of cell division occur during growth in the body and when there is need for cell replacement from old or damaged cells. It produce sex cell which are use for sexual reproduction.
Answer:
The correct answer is C. 1 and 11 only
Explanation:
What phase is it when Each daughter cell ends up with an identical set of chromosomes and about half the organelles. I know it is Mitosis but which specific phase of Mitosis?
Which choices are tenets of ecological forestry?
Choose all correct answers.
Silviculture should follow natural processes.
Foresters should consider economic priorities above ecological priorities.
Foresters should plan for the long-term and science should guide them.
Forests have intrinsic value, humans need to extract forest products, and social and economic concerns are important.
Answer:
silviculture should follow natural processes.
foresters should plan for the long-term and science should guide them.
forests have intrinsic value, humans need to extract forest products, and social and economic concerns are important.
Explanation:
took the test and notes.
When a person inherits the following combinations of alleles, which is dominant? Remember, the answer can be one of the alleles or
both of the alleles.
• A and B
• A and O
. B and O
Answer:
how do u post question lol
Answer:
You need just one copy to be dominant. Let's assume A is dominant so A & B
Which of the following are gene products?
mRNA
tRNA
tRNA synthetase
promoter
allele
nucleic acid
Answer:
I think its tRNA
Explanation:
Afforesting is a positive effort in curbing the over use and destruction of natural forests
Answer:
Explanation:
Afforestation simply refers to a campaign in favor of tree planting, against tree cutting in reserves or vegetation and the overall protection of the Forest reserve. Afforestation in the direct opposite of deforestation which is act of cutting down and destruction of forest trees. Trees are important part of our natural environment which plays economic, biological and chemical roles in the lives of the masses. Most notably, forest trees acts as carbon sink which in turn reduces depletion of the ozone layer. Even though their are economic derivatives in the cutting selling of forest planks for various purposes, tree planting culture must be legislated in other to avoid excessive use of forest reserves.
True or False: Protists can be
heterotrophs (consumers) or autotrophs
(producers).
Answer:
It is true
Explanation:
pls mark brainliest
Answer:
True
Explanation:
Autotrophs are producers because they can make their own food. Heterotrophs are known as consumers because they consume producers or other consumers.
please help me with this
Answer:
GGCCATAGGTCCCTTTAGCG
Explanation:
I got a 100%
what is smooth er resonibale for?
For every one bond created _ water molecule must be removed
Answer:4
Explanation:
For every bond created, four water molecules must be removed. Bonds break and join when molecules are formed.
What are chemical bonds?Different types of chemical bonds are present between different types of compounds, these bonds store energy and when the chemical reaction happens the reactance reacts they broke the bonds from the energy and create new compounds.
It takes a lot of heat to raise the temperature of liquid water, and an exceptional amount of heat to evaporate a given volume of water because hydrogen bonds need to be broken for the molecules to escape as gases.
Hydrogen bonds release water when they join or break. These bonds are formed in water and other compounds like DNA bases.
Therefore, four water molecules must be eliminated for every new link that is formed. When molecules are produced, bonds are broken and joined.
To learn more about chemical bonds, refer to the link:
https://brainly.com/question/15444131
#SPJ2
DNA is known as anti-parallel. In your own words, explain what this means.
Answer:
DNA is double stranded, and the strands are antiparallel because they run in opposite directions.
Explanation:
Each DNA molecule has two strands of nucleotides. Each strand has sugar phosphate backbone, but the orientation of the sugar molecule is opposite in the two strands.
Needing help on 9 and 10 please
Heyy! please help mee. This is missing and I need it turned in asap!
What is the most basic level of organization?
Name one thing smaller than a cell.
What is the third level of organization? and give an example of it______________________________.
An individual is also known as a ______________________________
Many organisms that are the same species are called a _______________________
What factor is NOT considered when looking at a community of organisms?
All biomes together create the ________________________
Answer:
Living things are highly organized and structured, following a hierarchy that can be examined on a scale from small to large. The atom is the smallest and most fundamental unit of matter. It consists of a nucleus surrounded by electrons. Atoms form molecules. A molecule is a chemical structure consisting of at least two atoms held together by one or more chemical bonds. Many molecules that are biologically important are macromolecules, large molecules that are typically formed by polymerization (a polymer is a large molecule that is made by combining smaller units called monomers, which are simpler than macromolecules). An example of a macromolecule is deoxyribonucleic acid (DNA) (Figure 1), which contains the instructions for the structure and functioning of all living organisms.

Figure 1. All molecules, including this DNA molecule, are composed of atoms. (credit: “brian0918″/Wikimedia Commons)
Some cells contain aggregates of macromolecules surrounded by membranes; these are called organelles. Organelles are small structures that exist within cells. Examples of organelles include mitochondria and chloroplasts, which carry out indispensable functions: mitochondria produce energy to power the cell, while chloroplasts enable green plants to utilize the energy in sunlight to make sugars. All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms. (This requirement is why viruses are not considered living: they are not made of cells. To make new viruses, they have to invade and hijack the reproductive mechanism of a living cell; only then can they obtain the materials they need to reproduce.) Some organisms consist of a single cell and others are multicellular. Cells are classified as prokaryotic or eukaryotic. Prokaryotes are single-celled or colonial organisms that do not have membrane-bound nuclei or organelles; in contrast, the cells of eukaryotes do have membrane-bound organelles and a membrane-bound nucleus.
In larger organisms, cells combine to make tissues, which are groups of similar cells carrying out similar or related functions. Organs are collections of tissues grouped together performing a common function. Organs are present not only in animals but also in plants. An organ system is a higher level of organization that consists of functionally related organs. Mammals have many organ systems. For instance, the circulatory system transports blood through the body and to and from the lungs; it includes organs such as the heart and blood vessels. Organisms are individual living entities. For example, each tree in a forest is an organism. Single-celled prokaryotes and single-celled eukaryotes are also considered organisms and are typically referred to as microorganisms.
All the individuals of a species living within a specific area are collectively called a population. For example, a forest may include many pine trees. All of these pine trees represent the population of pine trees in this forest. Different populations may live in the same specific area. For example, the forest with the pine trees includes populations of flowering plants and also insects and microbial populations. A community is the sum of populations inhabiting a particular area. For instance, all of the trees, flowers, insects, and other populations in a forest form the forest’s community. Keep in mind that the community level only consists of living organisms. The forest itself is an ecosystem; this is the first level that contains non-living aspects of a given area that impact the living things in that environment. An ecosystem consists of all the living things in a particular area together with the abiotic, non-living parts of that environment such as nitrogen in the soil or rain water. At the highest level of organization (Figure 2), the biosphere is the collection of all ecosystems, and it represents the zones of life on earth. It includes land, water, and even the atmosphere to a certain extent.
In general, which trophic level has the MOST energy available to it? a Producer b Primary Consumer c Secondary Consumer d Tertiary Consumer
Answer:
A producer
Explanation:
The trophic level which has the most amount of energy is the producer. Thus, the correct option is A.
What is a trophic level?The trophic level of an organism is the position which it occupies in a food web. A food chain is a succession of organisms which eat other small and simple organisms and may, in turn, be eaten up themselves or by higher organisms. The trophic level of an organism is the number of steps which it is from the start of the chain.
The food chain follows 10% energy law, where 10% of the energy is transferred to the next trophic level, this decrease with every trophic level limits the number of trophic levels in a food chain. The maximum energy is present in producers which perform photosynthesis.
Therefore, the correct option is A.
Learn more about Trophic level here:
https://brainly.com/question/13267087
#SPJ6
a forest is cut down to plant a field of corn. how will this affect the biodiversity of the area?
Answer:
well if the forest is no longer there the life within the forest will no longer be able to survive so that eliminates a group of living things in the area causing less diversity
(10 points) One of the accepted scientific theories describing the origin of life on Earth is known as chemical evolution. According to this theory, which of the following events would need to occur first for life to evolve?
Answer:
Synthesis of organic molecules
Explanation:
AnsweR: C
dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd LOOK OUSIDE YOUR WINDOW dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
What are the products of Photosynthesis?
Answer:
There are several small products of photosynthesis but the main product is glucose . Another main product is oxygen as well.
The effect of wearing tight clothes on the sperm production rate for some men.
please help
Where would the rate of erosion caused by water and gravity be the fastest? down the slope of a tall mountain in a V-shaped valley over an area of flat land down a hillside
Answer:
In a V-shaped valley
Explanation: Because the v-shaped valley has more of a slope than the others.
In dna different nucleotides can be created by changing the
Answer:
Different nucleotides can be created by altering the codons.
-Mutations
-Chemicals
-Insertion/Deletion
-Replication errors
-Genetics
In which Tetrads are not formed? Meiosis or Mitosis?
Answer:
No tetrads are formed in mitosis.
Explanation: Tetrads are formed in meiosis and lead to genetic recombination. After the formation of tetrads crossing over occurs. In humans, 23 tetrads are formed in meiosis.