How many times as great is 2x10^-8 is6x10^-3?

How Many Times As Great Is 2x10^-8 Is6x10^-3?

Answers

Answer 1

Answer:

300,000.

Step-by-step explanation:

6x10^-3 /  2x10^-8

= 3 x (10^(-3- (-8))

= 3 x 10^5

= 300,000


Related Questions

James wants to buy a new cell phone package there are three packages available for each offering a different deal which package offers the best deal​

Answers

Answer:package 3

Step-by-step explanation:

Hope I am right it is there cheapest

Suppose that 18 inches of wire costs 72 cents.
At the same rate, how much (in cents) will 14 inches of wire cost?

Answers

Answer:

[tex]56[/tex] cents

Step-by-step explanation:

If [tex]18[/tex] inches of wire cost [tex]72[/tex] cents, then each inch of wire will cost [tex]\frac{72}{18}=4[/tex] cents. Therefore, 14 inches of wire will cost [tex]14*4=56[/tex] cents. Hope this helps!

Answer:

56 cents

Step-by-step explanation: 72 cents divided by 18= 4 so for one inch of wire it cost 4 cents       Then 14 inches times 4= 56  I think thats

the answer

Alright y'all I'm doing homework and I don't really know what's this answer​

Answers

Answer:

25 red flowers

Step-by-step explanation:

red yellow

5 10

5 10

5 10

5 10

5 10

red=5+5+5+5+5=25

what is 9 : 45 = 6 : ?

Answers

Answer:6:45

Step-by-step explanation:

Answer:

x = 30

Step-by-step explanation:

a ratio is just a fraction

9:45 = 9/45

6:x = 6/x

now you have 9/45 = 6/x

cross multiply:

9 * x = 45 * 6

9x = 270

divide both sides by 9

9x/9 = 270/9

x = 30

Please help me :(
I will give you brainly

Answers

Answer:

i want to say neither

Step-by-step explanation:

-7x + 3y = 2

We dont know what x or y is.

Answer:

pretty sure its neither so D.

Step-by-step explanation:

Which values of a, b, and c correctly represent the answer in simplest form? 3 and one-half divided by 2 and one-fourth = a StartFraction b Over c EndFraction a = 1, b = 5, c = 9 a = 10, b = 18, c = 1 a = 9, b = 5, c = 1 a = 1, b = 10, c = 18

Answers

Answer:

a = 1, b = 5, c = 9

Step-by-step explanation:

3 1/2 ÷ 2 1/4

= 7/2 ÷ 9/4

= 7/2 × 4/9

= (7*4)/(2*9)

= 28/18

= 14/9

= 1 5/9

Therefore

3 1/2 ÷ 2 1/4 = a b/c

Where,

a = 1, b = 5, c = 9

Answer:

above is right

Step-by-step explanation:

Pls help I’m bad at math no matter how much I try

Answers

Answer:

no it is not

Step-by-step explanation:

Suppose there is a game of chance that you would like to play. It costs $3 to play one time. There are 100 $1 bills, 20 $5 bills, 3 $20 bills, and 1 $100 bill in a box. You may reach into a box without looking and select one bill. Is this a fair game? Why or why not?

Answers

Answer:

1. It is not a fair game.

2. The game is not fair because the probability of winning and the probability of losing are not equal.  In a fair game, the probability of winning is equal to the probability of losing.  In this game, the probability of losing is 0.81 or 81%, while the probability of winning is 19% (100 - 81).

Step-by-step explanation:

Cost of playing the game one time = $3

Total number of bills in the box = 124 (100+20+3+1)

Chance of losing is represented by 100 of $1 bills = 100/124 = 0.81 or 81%

Chances of losing are represented by 20 of $5 bills, 3 of $20 bills, and 1 $100 bill = 0.19 or 19% (20/124 + 3/124 + 1/124).

If the sales tax rate is 8%, how much tax would Luis pay for a pair of pants for $18 and two shirts for $9.99 each?

Answers

Answer:

$3.04 (rounded to nearest cent)

Step-by-step explanation:

Total cost without tax = $18 + $9.99 × 2

                                    = $37.98

Tax = [tex]\frac{8}{100}[/tex] × $37.98

      = $3.04 (rounded to nearest cent)

-1/4d-2/5d=39
Solve for d
Please explain I don’t understand

Answers

Given:

The equation is

[tex]-\dfrac{1}{4}d-\dfrac{2}{5}d=39[/tex]

To find:

The value of d.

Solution:

We have,

[tex]-\dfrac{1}{4}d-\dfrac{2}{5}d=39[/tex]

Taking LCM, we get

[tex]\dfrac{-5d-8d}{20}=39[/tex]

[tex]\dfrac{-13d}{20}=39[/tex]

Multiply both sides by 20.

[tex]-13d=39\times 20[/tex]

Divide both sides by -13.

[tex]d=\dfrac{39\times 20}{-13}[/tex]

[tex]d=-3\times 20[/tex]

[tex]d=-60[/tex]

Therefore, the value of d is -60.

Solve the following equation for x

5(x - 1) = -45

Answers

Answer:

solution: x = -8

Step by step:

1) 5x-5+5 = -45+5 : Add 5 to both sides

2) 5x= -40 : Simplify

3) 5x/5 = -40/5 : Divide both sides

Hope that helps

jsjsbsjdjsjannsnsns ​

Answers

Answer:

yes this is so normal to do

Answer


Thx for the points

Have a good night :)

Please help me I will give you an Brainly

Answers

Step-by-step explanation:

ok so its basically like addition the top + the bottom.

3x + 3y = 12

6x + 11y = 14

9x + 15y = 26

now u wat to cancel out

9x + 15y = 26

9                

15y = 26     y = 1.7

9x = 26      x = 2.8

i think this is right i hopw this helps

Answer:

y= -2

x= 6

there you go

I used elimination method!

Hope It Helps!!!!

15/9 into simplest form will give brainlest

Answers

15/3. = 5

9/3. = 3

5/3 os the answer

Answer:

1 6/9

Step-by-step explanation:

9 can only go into 15 once. So 15 - 9 = 6. 6 goes on top of the 9 and you get your answer of 1 6/9

What scale factor was applied to the first rectangle to get the resulting image?

Enter your answer as a decimal in the box.

Answers

Answer:

7.5/3= 2.5

i checked by doing

3*2.5 and it was equal to 7.5

the scale factor is 2.5

Answer:

2.5

Step-by-step explanation:

I divided 7.5 by 3 and got 2.5then to check my answer I multiplied 2.5 and 3 to get 7.5Hope this helps.

Arjun's piggy bank contains two kinds of coins and two kinds of bills. there are twice as many $1 bills like $5 bills. the number of quarters is 1 more than three times the number of $5 bills. and the number of dimes is 7 less than the number of quarters. how many of each type of bill and coin does Arjun have if the total is $39.90?

Answers

Answer:

$5 bills x 5, $1 bills x 10, quarters x 16, dimes x 9

Step-by-step explanation:

$5 bills = x, total = 5x$1 bills = 2x, total = xQuarters = 3x + 1, total = 0.25(3x + 1)Dimes = 3x + 1 - 7= 3x - 6, total = 0.1(3x - 6)

Equation below as the sum, solve for x:

5x + 2x + 0.25(3x + 1) + 0.1(3x - 6) = 39.97x + 0.75x + 0.25 + 0.3x - 0.6 = 39.98.05x  - 0.35 = 39.98.05x = 40.25x = 40.25/8.05x = 5

Number of each bill and coin:

$5 bills = 5$1 bills = 2*5 = 10Quarters = 3*5 + 1 = 16Dimes = 3*5 - 6 = 9

I need help with A and B

Answers

Answer:

a cube and a square-faced pyramid

2x+8y=56 on a 10x 10 grid

Answers

Answer:

Step-by-step explanation:

Simplifying

2x + -8y = 56

Solving

2x + -8y = 56

Solving for variable 'x'.

Move all terms containing x to the left, all other terms to the right.

Add '8y' to each side of the equation.

2x + -8y + 8y = 56 + 8y

Combine like terms: -8y + 8y = 0

2x + 0 = 56 + 8y

2x = 56 + 8y

Divide each side by '2'.

x = 28 + 4y

Simplifying

x = 28 + 4y

Tell whether the ordered pair (-4,-2) is a solution of the system of linear equations.

Y= 2x+6
Y= -3x-14

Answers

The ordered pair (-4,-2) is a solution for both of the equations

BRAINLIEST. Ariana has a loyalty card good for a discount at her local hardware store. The item she wants to buy is priced at $9, before discount and tax. After the discount, and before tax, the price is $7.56. Find the percent discount.

Answers

Answer:

16%

Step-by-step explanation:

Given data

Initial cost= $9

final cost= $7.56

Required

The percent discount

Step two

Percent discount= final-initial/initial *100

Percent discount= 9-7.56/9 *100

Percent discount=1.44/9 *100

Percent discount=0.16 *100

Percent discount=16%

Hence the percent discount is 16%

Yes

Yes

Yes

Yes

Yes

Yes

E

E

E

E

E

E

E

E

E

E

E

A 15% tip on a dinner bill is $3.60. How much is the bill?

Answers

Answer:

5

Step-by-step explanation:

if you add the tip it is 5 dollars

How long is a string reaching from the top of a 15 ft pole to a point 8ft from the bottom of the pole

Answers

Answer:

15.8

Step-by-step explanation:

So top of 15ft + 0.8 ft = 15.8 ft

meaning the strings needs tobe 15.8 ft long

a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at £110

Answers

Answer:

77 us dollar

Step-by-step explanation:

because I used a calculator

Answer:

77

Step-by-step explanation:

Merideth made a model of a pyramid like the one shown for history class.
What is the height of the model?

I un
15 in
app
The
Great!
e Building on the Essential Question How do you solve

Answers

Answer:

12

Step-by-step explanation:

there is a right angle so you can use Pythagoras therom to get the height it's going to be (15)^2-(9)^2 all under a square root = 12 in.

Triangle T is translated to Triangle T What is the translation from T to T'? у T T A 3 units left B 3 units right c5 units left 05 PLEASEEEE HELP ME OUT​

Answers

Answer:

5 units to the right!

It would take 3 unites to the right to get the 0 and then 2 more units to the right to get to 2, so that means 5 units in total to the right.

Can you please help me out? ;-;

In a right triangle, the length of one leg is 3 cm. The length of the other leg is 2 cm. What is the length of the hypotenuse?

Answers

Answer:

3^2+2^2=13

[tex] \sqrt{13} [/tex]

= 3.60555

Step-by-step explanation:

prove me wrong

Need help ASAP!!!!!!!

Answers

It is B have a nice day or night I don’t know what it is for you

I feel like this one might be a pretty easy question

Answers

Answer:

-29

Step-by-step explanation:

replace the variables with the numbers provided. m = -4 so replace the m in the equation with -4:

3 - (-4)n

same thing with the n.  n=-8 so replace the n in the equation with -8:

3 - (-4)(-8)

and then all you have to do after that is solve it using PEMDAS

multiply -4 and -8 first:

3 - 32

then solve 3-32 and you end up with -29.

Explore: Solving Two-Step Equations Solve the two-step equation. -9x + 0.4 = 4 Which operation must be performed to move all the constants to the right side of the equation? Then, which operation must be performed to isolate the variable? The solution to the equation is x = .

Answers

Answer:

x = -0.4

Step-by-step explanation:

Given:

-9x + 0.4 = 4

To move all constant to the right side of the equation, perform subtraction operation

That is, subtract 0.4 from both sides of the equation

-9x + 0.4 - 0.4 = 4 - 0.4

-9x = 4 - 0.4

-9x = 3.6

Perform division operation to isolate the variable

That is, divide both sides by -9

-9x / -9 = 3.6 / -9

x = -0.4

Answer:

1 Subtract 0.4

2 Divide by -9 on both sides

3 -0.4

Step-by-step explanation:

May I please have brainliest

Circle describe in your own words​

Answers

more info so i can answer
Other Questions
question in pic, plz help! name two reactions which are endothermic in nature.. Your class is using engineering principles to improve the design of football helmets to prevent brain injury. Your teacher divides you into groups and gives you various supplies (such as tape, bubble wrap, and foam) to create, design, and build a new helmet. Which of these is a benefit of this type of project in STEM education?Students learn to follow steps provided by their teacher.Students use household items to create new products.Students participate and apply engineering principles.Students become confident in working independently. I dont understand this Simplify cot^2 x sec^2 x How does Shakespeare use figurative language to develop a central idea in lines 203236? How many liters of CO2 gas can be produced at 30.0 C and 1.50 atm from the reaction of 5.00 mol of C3H8 and an excess of O2 according to the following equation? C3H8 (g) + 5O2 (g) 3CO2 (g) + 4H2O (g) please help me please help me please help me please help me Glider A of mass 0.355 kg moves along a frictionless air track with a velocity of 0.095 m/s. It collides with glider B of mass 0.710 kg moving in the same direction at a speed of 0.045 m/s. After the collision, glider A continues in the same direction with a velocity of 0.035 m/s. What is the velocity of glider B after the collision? What are the four emotional basic needs for the elderly? Plz, Help me with this question?? George spent 32,000 points for an upgrade in a video game. He spent 5/8 of the points on a castle and the rest on a spell. How many points did George spend on the castle and how many did he spend on the spell? Jenny has finished 15 of the 20 lessons in her piano book liam has finished the same percent of lessons from his piano book hi book contains 40 lessons how many lessons has liam fineshed need help on math plz help Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. PLEASE ANSWER ASAP FOR BRANLEST!!!!!!!!!!!!!!!Solve the equationb/4 +2 = -1what is b? Find |x| when x = 15 and x = 15. write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC how is the light from a grow bulb different from light from the sun. What is indirect object word order? (Latin)