Jack puts 1/3 pounds of birdseed every time he fills his bird feeder up. How many times can jack fill his bird feeder with 4 pounds of birdseed

Answers

Answer 1

Answer:

He can fill his feeder 12 times

Step-by-step explanation:


Related Questions

GIVING BRAINLIEST (20p)

Which statement is true?

a) all rhombuses are similar.

b) all rectangles are similar.

c) all isosceles trapezoids are similar.

d) all isosceles right triangles are similar.

Answers

Answer:

d

Step-by-step explanation:

have a nice day and good week. :)

I believe "option b" is the correct answer

Rico eats trail mix containing 1,000 calories. How many grams of trail mix does he eat?

Answers

What is the calorie count of each trail mix once you get that answer divide by 1000 and that’s the answer

A manufacturer produces 400 units when the market price is $10 per unit and produces 600 units when the market price is $12 per unit. Using the midpoint method, for this range of prices, the price elasticity of supply is about.

Answers

Answer:

your answer is $1,022 that is the answer

PLEASE HELPP!! 8th grade

Answers

Answer:

i think its 11.7

Step-by-step explanation:

Answer:

use pythag theorum you get 11.7 i thinkkk

Step-by-step explanation:

Try creating a triangle using the length of x and the length of y, so, you can tell the line goes from -5 to 5 on the x axis so that means its 10 long on x and 0 to 6 on y axis so its 6 long on y... then create a triangle and use the pythagorean theorem (the square root of (10 squared + 6 squared) which is around 11.7 .... i think, hope that helps! -prowl

SORRY THIS IS MY FIRST TIME ANSWERING A QUESTION ON HERE. I PUT IT IN THE WRONG PLACE THE FIRST TIME LOL

Find the value of X. Round to the nearest 10th. Diagram is not on the scale.

Answers

Answer:

Round to the nearest tenth. The diagram is not drawn to scale. Solution: We know that. cosθ = adjacent/hypotenuse. Substituting the values. cos22 = x/11.

Step-by-step explanation

hope this helps

What is the value of X
i will give brainliest

Answers

Answer:

x = 147

Step-by-step explanation:

all angles add up to 360

80 + 95 + 38 + x = 360

Hope this helps!!!

ANSWER Q IN PIC ASAP PLS- 50 POINTS

Answers

2x^2+5x-4=0

[tex]\\ \rm\hookrightarrow x=\dfrac{-b\pm\sqrt{b^2-4ac}}{2a}[/tex]

[tex]\\ \rm\hookrightarrow x=\dfrac{-5\pm\sqrt{25+32}}{4}[/tex]

[tex]\\ \rm\hookrightarrow x=\dfrac{-5\pm\sqrt{57}}{4}[/tex]

Jacks car has out of gasoline, he walks 12 km west and then 9 km south looking for a gasoline station, if he is now h km directly from his starting point find the value of h

Answers

Answer:

h = 20 km

Step-by-step explanation:

Mario's path forms a right triangle with legs 16 km and 12 km and hypotenuse h. Let's use the Pythagorean Theorem (a² + b² = c²) to solve for h.

16² + 12² = h²

256 + 144 = h²

400 = h²

h = 20 km

i hope this work for you

and sory if im wrang

Hey! Can anyone help me out with this? (It's Khan)

Answers

Answer:

Step-by-step explanation:

Like terms have same variable with same exponent

[tex]\dfrac{-4}{7}p+(\dfrac{-2}{7}p)+\dfrac{1}{7}= \left(\dfrac{(-4)+(-2)}{7} \right)p+\dfrac{1}{7}[/tex]    

                              [tex]=\dfrac{-6}{7}p+\dfrac{1}{7}[/tex]

The amount of money an accountant makes, m, for working h hours can be represented by the equation m = 29.4h. What is the constant of proportionality of the equation?

Answers

The constant of proportionality of the equation is 29.4

Variation constant

If the amount of money an accountant makes, m, is directly proportional to the time taken, this is expressed as:

m = kh

where;

k is the variation constant

Given that the amount of money an accountant makes, m, for working h hours is represented by the equation m = 29.4h, the variation constant is calculated as:

29.4h = kh

k = 29.4

Hence the constant of proportionality of the equation is 29.4

Learn more on variation constant here: https://brainly.com/question/25215474

JT scored 15 points from free throws in the championship game is it independent or dependent

Answers

Answer:

dependent variable

Step-by-step explanation:

from what i have seen this is the right choice heres an example of how i came up with it you can decide off of this

Independent variable causes an effect on the dependent variable. Example: How long you sleep (independent variable) affects your test score (dependent variable). ... Example: Your test score affects how long you sleep.

To the nearest hundredth, what is the length of line segment AB?

Drag your answer into the box.

The length of line segment AB is approximately units.

Answers

Answer:

5.83 units

Step-by-step explanation:

See attached picture.  You can use the Pythagorean Theorem.  I added some lines to show the legs of a right triangle.  AB is the hypotenuse.

[tex]3^2+5^2=(AB)^2\\\\9+25 = (AB)^2\\\\34=(AB)^2\\\\AB=\sqrt{34} \approx 5.83[/tex]

Answer:

5.83

Step-by-step explanation:

12 × 6 - 10 Which of the following is equal to the expression listed above? A. 6 × 12 - 10 B. 12 × 10 - 6 C. 10 × 12 - 6 D. 6 × 10 - 12

Answers

Answer:
A
EXPLANATION:
12x6-10=62
6x12-10=62

Below is the graph of a trigonometric function. It intersects its midline at (5.2, 7) and it has a minimum
point at (1.2, 1.2).
What is the period

Answers

Answer:

16

Step-by-step explanation:

We know the midline is

(5.2,7)

And the minimum is (1.2,1.2)

Note that the distance from the midline to minimum or max is 1/4 the distance of the period.

The period is respected to x so only look at the the x values.

So

Step 1: Find the distance from minimum point and midline.

[tex] |5.2 - 1.2| = 4[/tex]

Step 2: Multiply that by 4

[tex]4 \times 4 = 16[/tex]

So the period is 16.

Is △DBE similar to △ABC? If so, which postulate or theorem proves these two triangles are similar?



​△DBE​ is similar to ​△ABC​ by the ​SAS Similarity Theorem​.

​△DBE​ is similar to ​△ABC​ by the ​SSA Similarity Theorem​.

​△DBE​ is similar to ​△ABC​ by the ​SSS Similarity Theorem​.

​△DBE​ is not similar to ​△ABC​.

Answers

Answer:

△DBE​  is similar to ​△ABC​ by the ​SAS Similarity Theorem​.

Step-by-step explanation:

i took the test already

Gretta is having a birthday party and is buying pizza for everyone. She buys 32 pizza for 8. 00 dollars. What is the unit rate?

Answers

Answer:

.25 cents a pizza

Step-by-step explanation:

divide the 8 dollars by 32 to get 25 cents for the unit price

Write an expression that is equivalent to thank you:)

Answers

Answer:

You can write equivalent expressions by combining like terms. Like terms are terms that have the same variables raised to the same powers. For example, the list shows some pairs of like terms. the new coefficient is 9.

Step-by-step explanation:

[tex]hope \: it \: helps \: you[/tex]

Factor completely 9x4 12x3 21x2. 3(3x4 4x3 7x2) 3x(3x3 4x2 7x) 3x2(3x2 4x 7) Prime.

Answers

3x2(3x2 + 4x + 7)

hope this helps i solved it :)

Please I really need some help please please 15 points please
15 points
15 points
15 points
Please help
Please don’t answer if you don’t know how to or understand the question please









Two runners are racing against each other. Jeri graphs a linear equation for each runner that shows
the runner's distance from the starting line over time. The two equations form a system that has
infinitely many solutions. Describe the intersection point(s) of the lines and explain what the
solution means in this situation.

Answers

Answer:

If the graphs of the equations are the same, then there are an infinite number of solutions that are true for both equations. the intersection points (-3,3) Since the system is infinite it means there is 1 line on the graph-

Step-by-step explanation:

The solution (infinitely many solutions) in this case means the runners are at the same place at any point in time.

What does a system with  infinitely many solutions mean?

When a set of linear equations has a single solution,

In the case of coinciding lines with the same y-intercept, the number of solutions to the equation system is unlimited. The two lines are actually in the same line if they share the same slope and y-intercept.plied set then has a special solution.

We have two runners racing against each other.

The two equations form a system that has infinitely many solutions.

Thus, the solution (infinitely many solutions) in this case means the runners are at the same place at any point in time.

Learn more about infinitely many solutions here:

brainly.com/question/20430876

#SPJ2

pls pls help

Slope-Intercept Form

Answers

Answer:

y=(2/3)×-4

Step-by-step explanation:

4y(8/3)×-16 <-----divides everything by 3

Select all of the terms that are "like."

xy


2 x 2y


xy 2


2 xy


x 2


- xy

Answers

Answer:

I think the answer would be 2x2y 2xy x2 xy

Step-by-step explanation:

Hope this helps sorry if I am wrong.

The perimeter of a triangle is 90 cm.
The lengths of the sides of the triangle are in the ratios 3:5:7.
Work out the length of the longest side of the triangle.

Answers

Can you work out what one share is
If you don’t know comment

Let's call one ratio = x

So, the sides are 3x, 5x and 7x respectively.

Since the perimeter is 90 cm, the sum of 3 sides = 90 cm

-> 3x + 5x + 7x = 90 cm

-> 15x = 90cm
-> x = 6cm.

So, the 3 sides are 3x6, 5x6 and 7x6 -> 18,30 and 42.

Recheck : 18 + 30 + 42 = 90

18:30:42 = 3:5:7 (all divided by 6)

o Watch help video
A rental car company charges $34.32 per day to rent a car and $0.08 for every mile
driven. Christian wants to rent a car, knowing that:
• He plans to drive 325 miles.
• He has at most $250 to spend.
Which inequality can be used to determine x, the maximum number of days
Christian can afford to rent for while staying within his budget?
250 > 34.32x + 26
250 < 34.3226 + x)
Submit Answer
Ο Ο
250 > 34.32( 26 + x)
250 < 34.32x + 26

Answers

Answer:

325+250= 575

Step-by-step explanation:

Miles has six marbles in total in a bag (red, blue, green, yellow, purple, and orange). He selects two marbles without replacing the first. Enter your answers in simplified fraction form in the spaces provided. The probability that the first marble Miles selects is the yellow marble is The probability that the second marble Miles selects is the blue marble is​

Answers

Answer:

[tex]\frac{1}{30}[/tex]

Step-by-step explanation:

Separate into Case 1 and Case 2:

Case 1: We want a yellow marble

There is only 1 yellow marble out of the 6 marbles.

Probability for a yellow marble = [tex]\frac{1}{6}[/tex]

Case 2: We want a blue marble

There is only 1 blue marble out of the 5 marbles remaining. (We took 1 yellow marble out already)

Probability for a yellow marble = [tex]\frac{1}{5}[/tex]

Multiply Case 1 with Case 2 because they are a combination:

[tex]\frac{1}{6} *\frac{1}{5} =\frac{1}{30}[/tex]

Does anyone know the answer to all these three?

Answers

Answer:

A. 0.7

B. 0.7

C. 0.07

Step-by-step explanation:

7/10=0.7

70/100=0.7

7/100=0.07

These are easily solved by dividing the numerator by the denominator.
7/10=0.7
70/100=0.7
7/100=0.07

Help me to answer this pls​

Answers

Problem 1

x = measure of angle N

2x = measure of angle M, twice as large as N

3(2x) = 6x = measure of angle O, three times as large as M

The three angles add to 180 which is true of any triangle.

M+N+O = 180

x+2x+6x = 180

9x = 180

x = 180/9

x = 20 is the measure of angle N

Use this x value to find that 2x = 2*20 = 40 and 6x = 6*20 = 120 to represent the measures of angles M and O in that order.

Answers:Angle M = 40 degreesAngle N = 20 degreesAngle O =  120 degrees

====================================================

Problem 2

n = number of sides

S = sum of the interior angles of a polygon with n sides

S = 180(n-2)

2700 = 180(n-2)

n-2 = 2700/180

n-2 = 15

n = 15+2

n = 17

Answer: 17 sides

====================================================

Problem 3

x = smaller acute angle

3x = larger acute angle, three times as large

For any right triangle, the two acute angles always add to 90.

x+3x = 90

4x = 90

x = 90/4

x = 22.5

This leads to 3x = 3*22.5 = 67.5

Answers:Smaller acute angle = 22.5 degreesLarger acute angle = 67.5 degrees

Solve for v.
-3(v + 15) + 1 > 10

Answers

-3(v+15)+1>10
-3v-45+1>10
-3v-44>10
-3v>10+44
-3v>54
X<-18

A cylinder has a height of 15 feet and a diameter of 14 feet.

Answers

Answer:

cool... the question?

Step-by-step explanation:

Graph 1 suggests a linear relationship while Graph 2 suggests a non-linear relationship.

Both graphs suggest a linear relationship.

Graph 1 suggests a non-linear relationship while Graph 2 suggests a linear relationship.

Both graphs suggest a non-linear relationship.

Answers

Answer:

both graphs.suggest a non linear relationship

Sport Utility Vehicle (SUV) Sports Car Totals
male 21 39 60
female 135 45 180
Totals 156 84 240
Note: if you need to round, round to 2 decimals, like this: 12.34 %


Q1: What percent of males drive sports cars?

Q2: What percent of all drivers are male?

Q3: What percent of sports car drivers are male?

Q4: are questions 1 and question 3 the same? (yes or no)

Answers

The answer to Question 1 is 5%
Other Questions
Michael buys a pair of jeans that regularly costs $62. The jeans were discounted 30%. How much money did Michael pay for the jeans?Plss help 6 The system of equations shown below has no solution.Change one number in one of the equations so that thesystem has one solution. Graph your new system onthe coordinate grid to support your answer.y= 2x 1y = 2x + 1 use your knowledge of the root sens ("to feel"), occurring in such words as sense and sensory, along with context clues, to find the meaning of sensuous in the text brainly Figure out the next question What role did the Germanic tribes play in the fall of Rome? What artistic styles are traditionally most common in Islamicart? Select all true answers.GeometricStylizedNaturalisticFigurative1 pts A particle with a charge of +7.4 C is separated from another charged particle with a charge of-3.6 uC by a distance of 1.4 m. Find the direction and the magnitude of electrostatic forcebetween the particles. P1-1A On April 1, Julie Spengel established Spengel's Travel Agency. The following trans-actions were completed during the month.1. Invested $15,000 cash to start the agency.2. Paid $600 cash for April office rent.3. Purchased equipment for $3,000 cash.4. Incurred $700 of advertising costs in the Chicago Tribune, on account.5. Paid $900 cash for office supplies.6. Performed services worth $10,000: $3,000 cash is received from customers, and thebalance of $7,000 is billed to customers on account.7. Withdrew $600 cash for personal use.8. Paid Chicago Tribune $500 of the amount due in transaction (4).9. Paid employees' salaries $2,500.10. Received $4,000 in cash from customers who have previously been billed in transac-tion (6).Instructions(a) Prepare a tabular analysis of the transactions using the following column headings:Cash, Accounts Receivable, Supplies, Equipment, Accounts Payable, Owner's Capital,Owner's Drawings, Revenues, and Expenses.(b) From an analysis of the owner's equity columns, compute the net income or net lossfor April. Find the value of x. Leave your answer in simplest radical form. Select the correct answer.Simplify the following expression.x^-2/3 x x^6/7A. B. C. D. How do I work this out? Someone explain fully please 16.) The population of Wolf County was 12,390 in 2000 and 13,090 in 2010. Assuming that population growth in this county is linear, find the following: b.) When will the population reach 21,000 people? c.) When did the first settlers arrive in Wolf County? In the measurement 0.342, which number is the estimated digit? The (_______________________________) Clause means that states must recognize the judgments, legislation, and public records of other states. 1.Interstate Commerce2.Privileges and Immunities3.Due Process4.Equal Protection5.Full Faith and Credit Which subatomic particle is correctly paired with its properties?A) Proton: positively charged, mass about equal to that of an electronB) Neutron: no electric charge, mass about equal to that of a protonC) Electron: negatively charged, mass about equal to a neutronD) Positron: negatively charged, mass about equal to that of a proton. What event determines when a chromatid becomes a chromosome. Questions1. An object travels 3 meters in 1.5 seconds. What is its velocity? 7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA wouldyou see on the electrophoresis gel?BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 33TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5 GIVING BRAINALIST IF CORRECT + LIKESIs the tense correct in the example ?Were vegan our trip right now.A.)Yes B.)No HELP ME NOW!Which is a benefit of dynamic stretching? *increases heart rate increases oxygen and blood flow in the body improves range of motion all of the above