True or False: Ear training makes the connections between your musical mind, your ears, the sounds around you, music notation, and your instrument.

Answers

Answer 1

Answer:

True

Explanation:

think about your ears they have to do this kind of stuff sorry I am not good at explaining this stuff

Answer 2

I think it’s true I mean it has to b u explained it so well


Related Questions

How did the term “prairie style” come to be?
a.
The roofs and terraces that jut outward into the environment echo the horizontal space of the prairie.
b.
Homes were built in prairie states and were influenced by prairie landscape.
c.
The windows are arranged in long rows and are deeply cut into the brick walls, which adds a fortress-like quality to the home.
d.
all of the above

Answers

The answer is all of the above

The term “prairie style” come to be includes the roofs and terraces that jut outward into the environment echo the horizontal space of the prairie, homes were built in prairie states and were influenced by prairie landscape, the windows are arranged in long rows and are deeply cut into the brick walls, which adds a fortress-like quality to the home. The correct option is (D).

What do you mean by the Prairie Style?

Their concentration on the horizontal rather than the vertical is their most distinctive quality.

They are widely spaced out over their lots, with shallow or flat hipped rooflines, rows of windows, overhanging eaves, and bands of stone, wood, or brick running down the outside.

Frank Lloyd Wright established his architecture firm in Oak Park, a serene, semi-rural community on the western outskirts of Chicago, in 1893.

Therefore, the  term “prairie style” come to be includes the roofs and terraces that jut outward into the environment echo the horizontal space of the prairie, homes were built in prairie states and were influenced by prairie landscape, the windows are arranged in long rows and are deeply cut into the brick walls, which adds a fortress-like quality to the home.

To know more about the prairie style, visit:

https://brainly.com/question/1297408

#SPJ6

Legal contracts guide the relationship between artists and record labels.
A. True
B. False

Answers

the answer is going to be true

The given statement is true. Legal contracts guide the relationship between artists and record labels.

What are legal contracts?

Legal contracts are binding agreements between two or more parties that outline the terms and conditions of a particular exchange or relationship. They are used to establish clear expectations and protect the rights and interests of all parties involved in a transaction or arrangement.

Legal contracts are a fundamental part of the music industry, as they define the terms of the agreement between an artist and a record label. These contracts cover a range of issues, including the scope of the artist's work, the compensation they will receive, and the rights and obligations of both parties.

Therefore, the given statement is true. Legal contracts guide the relationship between artists and record labels.

Learn more about legal contracts, here:

https://brainly.com/question/3208041

#SPJ5

Please help me on the picture

Answers

This is personal to you if it’s talking about your goal say what you want to achieve(good grades, turn work on time etc.)
This is what you want to accomplish not what others want to do.

Bar’ in music can be referred to as
a. space
b. line
c. resting place
d. measure

Answers

Answer: measure

Explanation:

Bar is a musical term that means the number of beats that is being played at a particular time period and at a particular tempo.

A bar is simply a measure thatnis used in music and every bar consist of identical beats. Therefore, the answer to the above question will be option D "measure".

can anyone help with the riddles?? i’ll mark brainliest!

Answers

Answer: do u still need help??

just hmu

Explanation:

15. What does the C.O.R.E. stand for?

Answers

Answer:

Congress of Racial Equality

Explanation:

Read the excerpt from Heart of a Samurai.

Each of them was also given a metal stick, with four prongs on one end.

“Fork,” the sailor said – and showed them they should use it to eat the rice.

The fishermen recited their prayer before eating. “Itadakimasu – I will humbly receive.”

Then Goemon said, “It might be poison.”
What can readers infer based on details in the excerpt?
A. Goemon likes new experiences.
B. Goemon is not afraid of his rescuers.
C. Goemon does not trust his rescuers.
D. Goemon has used a fork before.

Answers

Answer:

C. Goemon does not trust his rescuers.

Explanation:

We see in the passage that fishermen prepare to eat and that sailor explains to them how to use the fork. However, the passage quotes Goemon that warily states the food might be poisonous.

This can tell us that Goemon does not trust sailors and he thinks that they might have poisoned the food in order to kill them. He is suspicious and afraid of these people and warns his fellow about the possible danger and his doubts.

what line and color family match tension ?

Answers

ANSWER: Mood lines

Can you guess this one...?

I never
Said I'd lie and wait forever
If I died
We'd be together
I can't always just forget her
But she could try
At the end of the world
Or the last thing I see
You are never coming home, never coming home
Could I? Should I?
And all the things that you never ever told me
And all the smiles that are ever, ever...
Ever get the feeling that you're never all alone?
And I remember now
At the top of my lungs in my arms she dies
She dies

Answers

I’m sorry, I don’t get it.

Answer:

omggg

Explanation:

Read the following and answer the question. Ortega knew he had to find the owner of the briefcase since it contained so much money. “I know I could have kept the money and no one would have known,” said Ortega. “But that’s not being honest.” Ortega spoke to the grocery store clerk and found the owner of the briefcase because he knew it was the right thing to do. Which of the following questions is most likely answered in this excerpt? Where did it happen? Why did it happen? Who did it? How did it happen? PLS ANSWER ASAP!! I WILL GIVE BRAINLY​

Answers

Answer:

Ortega did it

Explanation:

Because I saw it

What is Proportion is

Answers

Proposed is used to describe the size of one object in relation to another, each object is often referred to as a whole.

what is the primary type of articulations from peter ilyich tchaikovsky the nutcracker

Answers

ANSWER: tempo menuet.... I hope that’s right lol

Look at this photograph. This shows a Japanese
A. porcelain
B. dotaku
C. stupa
D mosque

Pls help

Answers

Answer: that would be a dotaku, its just a japanese bell

Explanation:

i hope this helps have a great day and dont forget to smile :)

Answer:

dotaku

Explanation:

It just it what it is man

Proportion is
a. the all-encompassing reproduction of a person or thing.
b. the relative size of an object as compared to another, or as compared to the other elements
in the piece.
the arrangement of visual elements in a piece, which helps to create understanding and
convey the artist's message.
the arrangement of elements in order to create equilibrium and a piece that is aesthetically
pleasing.
C.
d.
Please select the best answer from the choices provided
A
B
C
D

Answers

I think the answer is

B. the relative size of an object as compared to another, or as compared to the other elements in the piece..

what principle of design is used in the weeping woman

Answers

Answer:

huhbbcfukmbvdseryjknnbbvvftt6u I'm sorry

The 1984 song by Madonna was called...

A. Material World

B. Materials

C. Material Girl

Answers

Material World is the answer

Answer:

C) Material Girl was released in 1984 and was one of the songs of the " Like a virgin" album

At what building can the image below be found? Sculptures of the Last Judgement on a gothic cathedral in France.

Answers

Answer:

The Amiens Cathedral

Explanation:

The Amiens Cathedral also known as The Cathedral Basilica of Our Lady of Amiens is the Roman Catholic cathedral in France famous for its beautiful Gothic design and rich details.

The sculptures on the facade and inside the cathedral are one of the main characteristics of the cathedral. They are done mostly in relief, meaning they are attached to the background which is where the walls of the building.

The central sculptures are presented over the main door and show the image of the Last Judgment. That is the scene when the dead are raised by Christ, and so he is positioned in the middle, judging those below. On his sides are Virgin Mary and Saint John. Those who did well in life go on his right, to the Paradise, while the sinners are going to hell, on the left. On the arches above and around the scene, there are dozen of angels, sculptured in relief.

The Amiens Cathedral

What is your favorite animal? Why? (You don't need to answer the "why" part). This is for you mel. Also i have no clue what to put this subject in so please don't report it.

Answers

Answer:

my favortie pet is a dog (breed ) a german spherped

Explanation:

Tasmainian Devil because i don't know i just do and they're interesting


Look at this photo. These statues are located in

Pls help

Answers

Answer:d

Explanation:

The statues of Ahu Tongariki of the Easter Islands as shown in the image above are located in Polynesia.

What is the significance of the Easter Island statues?

The statues of Easter Island are megalithic monuments situated in Chile in the region of Polynesia. They are among the largest megalithic monuments in the world.

They are built along the Easter Islands as a ceremonial structure in the region and have great importance in all the Polynesian region.

Hence, option D; the statues of the Ahu Tongariki as shown in the image are located in Easter Islands of Chile in Polynesia.

Learn more about Easter Islands here:

https://brainly.com/question/26256943

#SPJ2

The method of paying wages at equal amount per week or month irrespective of quantity of work done is called __
a) Flat rate
b) Commission bonus
c) Time rate
d) Piece rate

Answers

a, flat rate. good luck!

Answer:

I believe its Flat rate or Time rate

what colors do you mix to get a charcoal black?

Answers

Answer:

half black and half white

Answer: Start with half balck and half white. Then add a small amount of yellow . Then add black and white as needed

Explanation:

what are the 6 benefits of teamworking?​

Answers

Answer:

Creativity thrives when people work together on a team. Brainstorming ideas as a group prevents stale viewpoints that often come out of working solo. Combining unique perspectives from each team member creates more effective selling solutions.

The person above is correct !!!!!!

Please hurry 100 points!
You learned about the four main parts of an art critique in this unit. If you had the opportunity to eliminate one of these parts and replace it with something else, what would you eliminate and add? Describe what step you would add to the critiquing process. Explain why you removed the step that you did.

Answers

Answer:

Explanation:

1.The ‘describe’ step of critiquing is to describe a technical description of a piece of art, telling exactly what you see, or the “visual facts.”

2.How is the ‘analyze’ step of critiquing done?-The ‘analyze ’step of critiquing done means to use the Elements and Principles of Design to reflect on a piece of art.

3.What does it mean to ‘interpret’ while critiquing?- ‘Interpret’ means to describe how the work of art makes you feel or what you think the artistes trying to say through their artwork.

4.Briefly describe what is involved with the ‘evaluate’ step of critiquing.- The ‘evaluate’ step of critiquing is evaluated in the art critiquing world means to judge the piece of art and decide how you feel about the piece overall.

Which of the following is enharmonic note for the new shown above?

Answers

Answer:

d flat so the first option

Explanation:

c sharp has the same fingering as d flat

Which of the following centuries would be part of the Renaissance?
The 1000s
The 1200s
The 1500s
The 1800s

Answers

Answer:

The 1500s

Explanation:

The renaissance began in the 1300s but gained the most attencion during the 1500s

Answer: the 1500s explanation

where do i put them?

Answers

Answer:

Explanation:

i think you put one on each line

i hope this helps

Answer:

here you go

Explanation:

i hope this is helpful

DO YOU KNOW WHO THIS IS!!
(also what is you favorite song)

Answers

Answer:

free points

Explanation:

who do you think encouraged Poorna malavath​

Answers

Answer her parents

Explanation:

impoverished farmers from the southern state of Andhra Pradesh, encouraged her during eight months of training despite the fact that she had never before been on a mountain.

Which camera function can you use for vertical framing of a shot?
A.
camera trigger
B.
grid reference
C.
spirit level
D.
long exposure

Answers

Answer:

its grid reference

Explanation:

i got it correct on edmentum

Bm meaning in marching band

Answers

Answer: okay okay okay
Other Questions
please help me please help me please help me please help me Glider A of mass 0.355 kg moves along a frictionless air track with a velocity of 0.095 m/s. It collides with glider B of mass 0.710 kg moving in the same direction at a speed of 0.045 m/s. After the collision, glider A continues in the same direction with a velocity of 0.035 m/s. What is the velocity of glider B after the collision? What are the four emotional basic needs for the elderly? Plz, Help me with this question?? George spent 32,000 points for an upgrade in a video game. He spent 5/8 of the points on a castle and the rest on a spell. How many points did George spend on the castle and how many did he spend on the spell? Jenny has finished 15 of the 20 lessons in her piano book liam has finished the same percent of lessons from his piano book hi book contains 40 lessons how many lessons has liam fineshed need help on math plz help Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. PLEASE ANSWER ASAP FOR BRANLEST!!!!!!!!!!!!!!!Solve the equationb/4 +2 = -1what is b? Find |x| when x = 15 and x = 15. write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC how is the light from a grow bulb different from light from the sun. What is indirect object word order? (Latin) local AM radio station broadcasts at a frequency of 685.9 kHz. Calculate the wavelength at which they are broadcasting. Wavelength A car wash can wash four cars in one hour. The table shows the total number of cars washed. How long will it take to wash 24 cars? HELLPPP PLEASE WILL GIVE BRAINLIEST Diffraction is useful in which of the following fields?a. calculusb. anthropologyc. astronomyd. astrology PLEASE HELPI think the answer is either 18 pounds or 26The scatter plot shows the weight of a baby panda in the months after it is born. How much would you expect a 5 month old baby panda to weigh? What is 10 divided by 5/8 The radius of a circle is 8 miles. What is the circle's circumference?