What was the biggest problem that existed in the constitution constructed to replace the Articles of Confederation - the one that almost resulted in the destruction of the country?

Answers

Answer 1
The articles of confederation were very weak and barely had A support system for The country as a whole

Related Questions

Which Greek city-state is renowned for having established the first democracy ("rule by the people") based on voting rights and full political participation for all male citizens?

Answers

The Greek city-state is Athens. While it wasn’t a “true democracy” it was the founding bedrock of it

i need help..........

Answers

Answer: C. is what I believe it is

negative social changes a new student encounters at university or college

Answers

Some might try to fit in with the others wether that’s drinking or whatever so that can lead to a drastic negative social change. And a lot of people over think everything when growing up/ going into college which can lead to less social confidence. And a lot of the college involved stress leads to very drastic social changes that are different for everyone

Current ethical standards for psychology experiments were established by Freud in the 1920s. Please select the best answer from the choices provided T F.

Answers

No, it is false that current ethical standards for psychology experiments were established by Freud in the 1920s.

Who established ethical standards for psychology?

Watson and Raynor conducted the experiment named "The Little Albert" that demonstrated how classical conditioning is used to create a phobia by using a white rat and baby.

Therefore, a lab experiment was performed where the reaction of baby Albert due to a conditioned stimulus was filmed.

Learn more about psychology here:

https://brainly.com/question/7097870


What do u mean by art

Answers

Answer:

Art is the expression or application of human creative talent and imagination, usually in the form of a visual medium such as painting or sculpture, that results in works that are valued primarily for their aesthetic value or emotional force.

Answer:

Painting, music, literature, and dace.

Explanation:

Art is the expression of creative skills by humans. Most art takes place in visual form, like the Mona Lisa or Starry Night, but art can also be made into other forms, like music, dance, and even writing. Anything that is creatively expressed is a different form of art.

What age can you get a tattoo with parental consent.

Answers

I believe the person has to be 16

How many states stayed with the U.S.?

Answers

Answer:

34 states is your answer

Which of the following was NOT true of Portuguese seagoing efforts: _________
a) Early settlements included Newfoundland and the New England coastline.
b) They initially explored the coastline of West Africa.
c) They had well trained, expert sailors.
d) They eventually initiated trade with China and India.
e) They used three-masted ships called caravels.

Answers

This question should be A.

How long before the Civil War was the original Constitution written?

Answers

The constitution was writer during the Philadelphia convention which convened from may 25 to sep 17, 1787. The constitution was signed on September 17, 1787


Hope this helps! :)

Discuss THREE reasons why it is important to express your point of view in a relationship?

Answers

Answer:

so that your relationship can go strongwr

Communication is very important

trsut honestly and loyaly goes a long way

Answer:

1) it is important for you and your partner to both talk about your feelings towards each other, especially if your partner does something you dislike, let them know it wasn't okay

2) it's good for your partner to know what you're thinking and planning so you can be on the same page and know what each other is up to

3) your partner might think something different than you so its important to tell them your point of view to help them understand you better

How does Karen Dynan recommend readers become a part

of the solution?

A. Order items online

B. Stop using coins

C. Exchange coins for bills

D. Go on a trip somewhere fun


( will give brainliest if you help)

Answers

Answer:

C

Explanation:

and can u make me brainliest

An example of a peer group is

Answers

Explanation:

Examples of peer groups include: Sports teams of which we are a part of (i.e. basketball, soccer, football, ballet) School organizations and clubs (i.e. chess club, science club, band, orchestra) Classmates.

Answer:

Examples of peer groups include:

Sports teams of which we are a part of (i.e. basketball, soccer, football, ballet) School organizations and clubs

(i.e. chess club, science club, band, orchestra) Classmates.

True or False: Trade cities became very strong and powerful because of their locations.

Answers

Answer:

True

Explanation:

Trading cities played an important role in the spread of goods on the Silk Road and Indian Ocean trade routes.

One feature that distinguishes carl rogers’ person-centered approach to personality development from behaviorist approaches to personality development is that the person-centered approach suggests that.

Answers

The feature that distinguishes carl rogers’ person-centered approach to personality development  suggests that:

Personality is one that is shaped by a kind of unconditional love and support for children's behavior, and the behaviorist approaches is one that states that personality is said to be conditioned via rewards and punishments.

What is the feature of personality according to Carl Rogers?

Carl Rogers is known to be one that states that the tool or ingredients of a good growth environment are said to be genuineness, acceptance and empathy.

His Self-concept was said to be a key feature of personality for both Maslow and Rogers.

Learn more about personality development from

https://brainly.com/question/5785499

"The Second World War was greatly guided by the feeling of revenge." Write a letter to your friend justifying that the revenge invites destruction.

Please help!!:)​

Answers

The answer is in the attachment it always says that "It appears that your answer contains either a link or inappropriate words. Please correct and submit again!" and Sry for late too.

Which statement about all three myths is true? Question 4 options: They feature gods and goddesses as characters. They depict the "land of the dead" as a physical place. They feature a relative trying to save a loved one from death.

Answers

Answer:

They depict the “land of the dead” as a physical place

Explanation:

I did the test and it was right

Analyse how each of the following factors could be regarded as positive to any relationship and your well-being.
1.choices
2.Goal setting​

Answers

The Analyses Goal setting​ and choices as a  positive to any relationship and your well-being is below.

The role of Goal setting  in well being?

Goal setting is one that aid or help a person to have an improve health and wellbeing, It brings about positive relationships with friends, family or work colleagues and others.

Choice are said to bring about a kind of balance of power in a relationship. Choice enhance well being as it reduces friction and give the source strength if both partners decide together in a relationship.

Learn more about Goal setting​ from

https://brainly.com/question/1409468

_______ is the mostly unconscious process of organizing people and objects into preconceived categories that are stored in our long-term memory.

Answers

Answer:

categorical thinking

Explanation:

Your etiquette and ethics on the sports field are a reflection of your overall character. Please select the best answer from the choices provided. T F.

Answers

According to the sentence, your etiquette and ethics on the sports field are a reflection of your overall character is True.

How your ethics and etiquette reflect your character?

Under every sports, particular team player's ethics and etiquette reflect through their team spirit and how they behave with their team mates.

There are some Athletes who play the game through giving the respect to their competitors and some are not.

One sports person need to be honest in the game with himself/herself in order to win the game.

Therefore, the answer is true.  

Learn more about ethics, refer to the link:

https://brainly.com/question/25799298

Answer:

true

Explanation:

edge

Betty, a two-month-old infant, is not afraid when strangers pick her up and play with her. She is also equally comfortable when familiar people pick her up. Betty is showing _____.

Answers

Answer:

Betty is showing indiscriminate attachment

Explanation: Hope this helps:)........if not I hope you find what you're looking for:)

Please help lol.

How are New York and New Orleans alike?
How are they different?

Answers

No there not alike they just look alike

Due to the massive labor shortages created by WWII, the federal government instituted a program to bring in thousands of Mexicans to work on a temporary basis. What was this program called?

Answers

Answer:

The Bracero Program

Explanation:

An executive order called the Mexican Farm Labor Program established the Bracero Program in 1942. This series of diplomatic accords between Mexico and the United States permitted millions of Mexican men to work legally in the United States on short-term labor contracts.

Why conflict is healthy?Critically discuss this statement ​

Answers

Answer:

In fact, conflicts can be good for organizations because it encourages open-minded attitude and helps prevent groups from being attacked by many organizations. It is necessary to learn how to effectively handle the conflict, so that instead of organizational development it may act as catalyst instead of catalyst

what is the present status of international trade in Nepal ?​

Answers

Answer:

Nepal had a total export of 740,742.91 in thousands of US$ and total imports of 10,037,840.17 in thousands of US$ leading to a negative trade balance of -9,297,097.26 in thousands of US$The trade growth is 3.66% compared to a world growth of 5.68%. GDP of Nepal is 30,641,380,604 in current US$

Explanation:

hope this helps <3

__________ describes the process in which children learn new words and then begin to form a mental map of interconnected sets of word categories.

Answers

The blank space in the question should be filled with; Literacy and Language development.

Language Development in Children

According to B. F. Skinner, a learning theorist, who suggests that language develops through the use of reinforcement. Sounds, words, gestures, and phrases are encouraged by following the behavior with words of praise or any thing that increases the likelihood that the behavior will be repeated.

On this note, it follows that the sounds and words are accompanied by a mental map of interconnected sets of word categories.

Read more on language development;

https://brainly.com/question/2623648

Which benefits does Judge Flanagan discuss in the video? Check all that apply.

Answer Options:

A. a reduction in crime
B. an end to unruly acts
C. higher rates of rehabilitation
D. lowered costs for taxpayers
E. faster sentencing in the courts
F. better conditions in detention centers

Answers

A judge is responsible for being in charge  of a case in a law court and can pass judgments on an accused.

What is Crime?

This refers to the break down of law and order in a given place when people engage in criminal activities.

With this in mind, we can see that if there is a reduction in crime, then the community would be safer and there would be an end to unruly acts and this would lead to lasting peace,

Please note that your question is incomplete so I gave you a general overview to get a better understanding of the concept.

Read more about crime here:
https://brainly.com/question/19238665

Answer:

a reduction in crime

higher rates of rehabilitation

lowered costs for taxpayers

better conditions in detention centers

Explanation:

After a severe car accident, Tristan struggles to comprehend what people are saying when they speak to him. He probably has damage to

Answers

If Tristan has issues comprehending the speech of people following the accident he has damage to his Wernickes area.

What is the Wernickes area?

This is the area of the brain that houses the motor neurons that help people in the comprehension of speech.

This is the area that is said to have been damaged in this accident. It is the reason he has issues with comprehension.

Read more on Wernickes area here:

https://brainly.com/question/6716809

Enuresis may be caused by ______. Group of answer choices hyperactivity of the prefrontal cortex. An immature motor cortex. Lack of specific neurotransmitters needed to achieve physical control. A pathological connection in the diencephalon

Answers

Enuresis is the medical name for not being able to control your pee. In other words, enuresis is also known as involuntary urination.

Causes of Enuresis

It is caused by both primary and secondary factors. One of the causes is Lack of specific neurotransmitters needed to achieve physical control. This is related to neurological problem such as seizure, spinal dysnaphism.

Therefore, the answer to it is Lack of specific neurotransmitters needed to achieve physical control.

learn more about enuresis from here: https://brainly.com/question/5889770

What is the name of the large sandstone formation in the barren outback of central australia?.

Answers

Answer:

Uluru. also known as Ayers Rock

Explanation:

it is a large sandstone formation in the southern part of the Northern Territory in Australia. It lies 335 km (208 mi) southwest of the nearest large town: Alice Springs.

__________ is when frequently used brain synapses begin to strengthen and rarely used connections begin to prune. A. Induction B. Plasticity C. Synaptogenesis D. Elasticity.

Answers

Synaptogenesis is frequently used brain synapses begin to strengthen and rarely used connections begin to prune.

What is Synaptogenesis?

Synaptogenesis is defined as the construction of synapses between nerve cells in the nervous system.

It is a flamboyant scientific phrase that only represents nerve cells that are constructing unique relationships.

This fast duration of synaptogenesis contests a critical role in understanding, memory construction, and transformation early in life.

The number of synapses hits a peak level at about 2-3 years of age.

Therefore, option C is correct.

Learn more about the brain synapses, refer to:

https://brainly.com/question/5411512

Answer:

The answer is C. Synaptogenesis

Explanation:

I got it correct, hope this helps

Other Questions
Long-term potentiation: Group of answer choices refers to the functional and structural changes in neurons that increase the strength of the synaptic connections involved in a particular memory. Michael buys a pair of jeans that regularly costs $62. The jeans were discounted 30%. How much money did Michael pay for the jeans?Plss help 6 The system of equations shown below has no solution.Change one number in one of the equations so that thesystem has one solution. Graph your new system onthe coordinate grid to support your answer.y= 2x 1y = 2x + 1 use your knowledge of the root sens ("to feel"), occurring in such words as sense and sensory, along with context clues, to find the meaning of sensuous in the text brainly Figure out the next question What role did the Germanic tribes play in the fall of Rome? What artistic styles are traditionally most common in Islamicart? Select all true answers.GeometricStylizedNaturalisticFigurative1 pts A particle with a charge of +7.4 C is separated from another charged particle with a charge of-3.6 uC by a distance of 1.4 m. Find the direction and the magnitude of electrostatic forcebetween the particles. P1-1A On April 1, Julie Spengel established Spengel's Travel Agency. The following trans-actions were completed during the month.1. Invested $15,000 cash to start the agency.2. Paid $600 cash for April office rent.3. Purchased equipment for $3,000 cash.4. Incurred $700 of advertising costs in the Chicago Tribune, on account.5. Paid $900 cash for office supplies.6. Performed services worth $10,000: $3,000 cash is received from customers, and thebalance of $7,000 is billed to customers on account.7. Withdrew $600 cash for personal use.8. Paid Chicago Tribune $500 of the amount due in transaction (4).9. Paid employees' salaries $2,500.10. Received $4,000 in cash from customers who have previously been billed in transac-tion (6).Instructions(a) Prepare a tabular analysis of the transactions using the following column headings:Cash, Accounts Receivable, Supplies, Equipment, Accounts Payable, Owner's Capital,Owner's Drawings, Revenues, and Expenses.(b) From an analysis of the owner's equity columns, compute the net income or net lossfor April. Find the value of x. Leave your answer in simplest radical form. Select the correct answer.Simplify the following expression.x^-2/3 x x^6/7A. B. C. D. How do I work this out? Someone explain fully please 16.) The population of Wolf County was 12,390 in 2000 and 13,090 in 2010. Assuming that population growth in this county is linear, find the following: b.) When will the population reach 21,000 people? c.) When did the first settlers arrive in Wolf County? In the measurement 0.342, which number is the estimated digit? The (_______________________________) Clause means that states must recognize the judgments, legislation, and public records of other states. 1.Interstate Commerce2.Privileges and Immunities3.Due Process4.Equal Protection5.Full Faith and Credit Which subatomic particle is correctly paired with its properties?A) Proton: positively charged, mass about equal to that of an electronB) Neutron: no electric charge, mass about equal to that of a protonC) Electron: negatively charged, mass about equal to a neutronD) Positron: negatively charged, mass about equal to that of a proton. What event determines when a chromatid becomes a chromosome. Questions1. An object travels 3 meters in 1.5 seconds. What is its velocity? 7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA wouldyou see on the electrophoresis gel?BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 33TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5 GIVING BRAINALIST IF CORRECT + LIKESIs the tense correct in the example ?Were vegan our trip right now.A.)Yes B.)No