Is this correct I need sum helpp
predict what will occur in your body after a vigorous run. Explain the chemical process that supports your prediction.
Answer:
More blood is pumped to the exercising muscles to deliver that additional O. Without enough oxygen, lactic acid will form instead. Lactic acid is typically flushed from the body within 30 to 60 minutes after finishing up a workout.
Explanation:
I hope this helped ;)
10) COMPRESSIVE STRESSES, GRANITIC MAGMAS, AND
INTERMEDIATE DEPTH EARTHQUAKES ARE ASSOCIATED WITH
5. Can this difference lead to differential reproductive success within the moth population? How and
why?
When you make questions you need to make sure you complete them '-'
*what difference?
If you fix it ill try to answer it.
A dominant trait is always_______.
A. A darker color
B. A bigger feature
C. Expressed over recessive
Answer:
C
Explanation:
Expressed over recessive.
Answer:
C
Explanation:
Dominant trait is always expressed over recessive when they are crossed.
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following
sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.
Which of these revisions to the model would be most useful for the researcher to include?
O
A Replace thymine (T) with uracil (U) in the DNA molecule.
B
Keep the two strands of the DNA molecule joined together.
C. Identify promoter and "stop" regions on the DNA molecule.
O
D. Divide the DNA molecule into pieces that are 40 to 50 bases long
Review progress
Question 36
of 40
Back
Next →
The revisions to the model that would be most useful for the researcher to include is the replacement of thymine (T) with uracil (U) in the DNA molecule.
What do you mean by Transcription?Transcription may be defined as a process by which DNA is converted into mRNA in the nucleus of the cell.
In RNA, thymine is replaced by Uracil because during the elongation process, the presence of adenine in the DNA strand message the RNA polymerase to attach uracil in the complementary area of the elongated RNA strand.
Apart from this, Uracil requires less energy in the production as compared to thymine.
Therefore, the revisions to the model that would be most useful for the researcher to include is the replacement of thymine (T) with uracil (U) in the DNA molecule.
To learn more about Transcription, refer to the link:
https://brainly.com/question/1048150
#SPJ2
Why is DNA an important molecule for our cells
Answer:
DNA is pivotal to our growth, reproduction, and health. It contains the instructions necessary for your cells to produce proteins that affect many different processes and functions in your body. Because DNA is so important, damage or mutations can sometimes contribute to the development of disease.
what part of a cell contains pigments
of colors other
than green.
Answer: orange and yellow
Explanation:
Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?
A. endoplasmic reticulum
B. ribosome
C. cell membrane
D. nucleus
Answer: C
Explanation: cell membrane
Which diagram looks most like a plant cell?
What is the function of the green circles in “B”?
What is the difference between the outer covering of “A” and “B”?
B, Ribosomes and they are a cell structure that makes protein, in "A" it only has a cell wall and in "B" it has both cell wall and cell membrane
What percentage of the world's cropland soil is considered seriously degraded?
Answer:
75%
Explanation:
Approximately 33% of the world's cropland soil is considered seriously degraded.
Soil degradation is a significant global challenge that affects agricultural productivity, food security, and the environment. Seriously degraded soil refers to land that has lost its fertility, structure, and nutrient content to a severe extent, making it unsuitable for sustained crop production without significant interventions.
This degradation can result from factors such as erosion, deforestation, intensive agricultural practices, overuse of chemical fertilizers and pesticides, and climate change. As a consequence, a considerable portion of the world's cropland, around 33%, faces serious soil degradation, posing a threat to future food production and necessitating sustainable land management practices to address this issue.
To know more about soil here
https://brainly.com/question/1286340
#SPJ2
how certain structures affect the function of reduced collision impact? PLEASE ITS DUE IN 30 MINS I NEED AN ANSWER
Answer:
When the size of a fixed mass of a solid reactant decreases, the rate of reaction increases.
This can be explained using the collision theory, as below:
When the size of a fixed mass of a solid reactant becomes smaller, the total surface area exposed to collision with the particles of the other reactants increases As a result, the frequency of collision among the reacting particles at the surface of the solid reactant increases. This causes the frequency of effective collision to increase. Hence, the rate of reaction increases.
Explanation:
3. What types of organisms are present in a healthy soil ecosystem?
Answer:
archaea, bacteria, actinomycetes, fungi, algae, protozoa, earthworms, etc.
Explanation:
what will happen to the paper clips if you have struck the table hard enough?
Answer:
The paper clips will begin to vibrate back and forth if you have hit the table hard enough.
Explanation:
Thanks to the "spring" repulsive nature of the atomic lattice, vibrations that reverberate through the rest of the nearby structure are produced by warping .
Which color are the hottest stars?
blue
orange
red
yellow
Answer:
blue stars are the hottest :)
Answer:
A
Explanation:
I believe that blue stars are the hottiest and red are the coolest so opposite of what you would think
what is Chlamydomonas?
Chlamydomonas is a unicellular algae. It occurs in many Varieties .Most of these are free floating,fresh water green algae.
More informationthe plant body is unicellular and biflagellate. the cell is spherical or cylindrical in shape .the Protoplasm of the cell is always surrounded by a thin cellulose wall .a pair of flagella of equal size is present at the anterior end. it moves by the lashing actions of the flagella. usually two contractile vacuoles are present .it contains a single nuclear suspended in colourless portion of the cytoplasm .1___________________________________ Consiste en el despliegue u ordenamiento de los cromosomas por pares idénticos de acuerdo a sus características morfológicas.
are dominate traits always more common within a population
Answer:
Yes
Explanation:
Because dominate always tops recessive, recessive isn't as popular as dominate traits.
What stage are haploid cells seen in?
Answer:
metaphase
Explanation:
Give the genotype of male offspring.
Answer:
XY
Explanation:
What is the most likely reason for the increase in bird populations in the wetlands?
Answer:
wetlands have an incredible amount of water and therefore are ideal for birds
Explanation:
Answer:
wetland factors that affect the birds. the relation between wetlands and birds shaped by many factors .
they are :
depth and quality of the water .
Explanation:
I hope it helps you ✌
3. Does the following diagram show digestion or synthesis? How do you
know?Explain!!!!
Your answer
Answer:
Digestion
Explanation:
Digestion is breaking up food which in the photo is triangles going from together to separated.
How are humans changing the carbon cycle?
Humans are planting more trees to add more oxygen to to the carbon cycle.
Humans are adding carbon to the Earth by over-farming,
Humans are burning carbon and putting it into the atmosphere.
Humans change the carbon cycle by burning carbon and putting it into the atmosphere. Thus, the correct option for this question is C.
What is the Carbon cycle?The carbon cycle may be defined as a type of biogeochemical cycle through which carbon atoms continually travel from the atmosphere to the Earth and then back into the atmosphere. This cycle governs the exchange of carbon and its derivatives among the biosphere, pedosphere, geosphere, hydrosphere, and atmosphere of the Earth.
The activity of Plants in the carbon cycle is determined by the fact that they breathe carbon dioxide. Humans are often cutting them down and the carbon dioxide stays in the air.
Apart from this, the burning and combustion of fossil fuels, trees, and chemicals increase the level of carbon in the atmosphere. Due to these human actions, the carbon cycle may be changing gradually.
Therefore, the correct option for this question is C.
To learn more about Carbon cycle, refer to the link:
https://brainly.com/question/2272536
#SPJ6
plz help me plz asap i will mark you as brianlist
Answer: b is steady increasing in distance. a is not increasing in distance. E is decreasing in distance.
Explanation:
group of animals with the same characteristics
Answer:
chordata
Explanation:
chordata is a phylum that collet many animal whose same characteristic
in what structures are diploid cells produced? how does this occur
Answer:
Early in the development of the embryo, specialized diploid cells, called germ cells , are produced within the gonads (such as the testes and ovaries). Germ cells are capable of mitosis to perpetuate the germ cell line and meiosis to produce haploid gametes.
Which one the large organs allow nutrients and water to pass through the walls
Answer:
The walls of the small intestine absorb water and the digested nutrients into your bloodstream. As peristalsis continues, the waste products of the digestive process move into the large intestine.
Explanation:
Please mark me brainliest
I need help !!
Question: what is important function of the cell structure in the plasma membrane?
Which of the following is a characteristic of an index fossil?
A.
The fossil is found only in an isolated part of the world.
B.
The fossil organism must have lived during a long span of Earth's history.
C.
The fossil must be found in great numbers.
D.
The fossil must look like many other fossils.
Answer:
C
Explanation: because Index fossils Have to found in a lot of places but in one time period.
Answer:
the answer is c
Explanation: index fossils has to be found in great numbers to be considered one.
4. The word "glycolysis" is essential to understanding cellular respiration.
Answer:
The conversion of glucose to lactate is known as anaerobic glycolysis, since it does not require oxygen. However, it is not true to say that human metabolism (apart from red blood cells) is ever wholly anaerobic.
