Which of the following is true about soil color? a. Soil vary in color based on their mineral content. b. Soils do not vary in color based on their minimal content. c. Soils consisting of only a few minerals are always darker. d. Soils is consisting of many different minerals are always darker.

Answers

Answer 1

Answer:

A

Explanation:

cant explain gtg

Answer 2

Answer:A

Explanation:


Related Questions


Neurons are either classified by their structural differences or their ? differences.

Answers

Nerve cells are functionally classified as sensory neurons, motor neurons, or interneurons. Sensory neurons (afferent neurons) are unipolar, bipolar, or multipolar shaped cells that conduct action potentials toward or into the central nervous system.

Which two structures are found at the outside of the cell?

Answers

Answer:

All cells share common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell.

A male and a female are both heterozygous for a particular trait. Which of the following represents the expected ratio of dominant to recessive phenotypes in the offspring?

Answers

The given question is incomplete as it lack the options, however, answer can be given by the provided information.

Answer:

The correct answer is - 3:1 ratio.

Explanation:

In the question it is given that both male and female both are heterozygous for the trait, let assume dominant allele A and recessive allele a so the the gene for the both male and female is Aa.

Punnett square for the cross between both:

gametes: A, a and A, a.

A a

A AA Aa

a Aa aa

here two out of four are heterozygous dominant and one is dominant and one is recessive.

thus, 3 out of 4 are dominant and one out 4 are recessive.

thus, the answer is 3:1 ratio

Answer:

For the 4th time I need more points and its C

Explanation:

Please select the word from the list that best fits the definition
Is half the size of Earh, has two moons, and has an atmosphere of mostly carbon dioxide

Mercury
Earth
Mars
Venus

Answers

The answer is Mars, because Venus and Mercury have no moons. Earth has one moon.

Answer:

The first person is correct, the answer is Mars.

Explanation:

_______$$__$_______________

_______$___$$______________

_______$___$$______________

_______$$___$$_____________

________$____$$____________

________$$____$$$__________

_________$$_____$$_________

_________$$______$$________

__________$_______$$_______

____$$$$$$$________$$______

__$$$_______________$$$$$$

_$$____$$$$____________$$$

_$___$$$__$$$____________$$

_$$________$$$____________$

__$$____$$$$$$____________$

__$$$$$$$____$$___________$

__$$_______$$$$___________$

___$$$$$$$$$__$$_________$$

____$________$$$$_____$$$$

____$$____$$$$$$____$$$$$$

_____$$$$$$____$$__$$

_______$_____$$$_$$$

________$$$$$$$$$$

why does food get cold but drinks get hot​

Answers

Answer:

it might be because of the room temperature.

Explanation:

since drinks are colder than the room temperature they will get warmer to be the same as the room temperature and because food is hotter than room temperature it gets colder to be the same as the room temperature. dont quote me on that just a guess

When equipment malfunctions, a(n) _____ needs to be initiated.

A) Notification

B) Paper Work

C) Alarm

D) Work Order

Answers

Answer: Alarm

Explanation:

When equipment malfunctions, an alarm should be initiated to bring the malfunction to the attention of the relevant personnel.

This will ensure that whatever adverse effects the malfunction could have caused is mitigated and the machine can be attended to on time to prevent further damage.

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

What are the three blood types? Explain how there could be an AB blood type.

Answers

Answer:

AB

O

A

B

the AB blood type is created (mostly) by someone with A blood type making a baby with someone with B blood.

Explanation:

The human blood group is classified into four major classes which are A, B, AB, and O. This is possible due to multiple allelism and codominance which are found in the alleles A and B.

What is blood typing?

A blood type is the classification of blood into different groups, based on the presence or absence of antibodies and inherited antigenic substances on the surface of the red blood cells which are present in the blood. These antigens may be proteins, carbohydrates, glycoproteins, or the glycolipids, depending up on the blood group system.

In humans, the blood typing is of four types that is A, B, AB, and O. This is because, the blood typing is an example of multiple allelism and codominance. A and B alleles are codominant and O is recessive.

Learn more about Blood typing here:

https://brainly.com/question/256625

#SPJ2

how is cancer cell division different from regular cell division

Answers

It is different because it has different DNA and diff molecules

Choose all the right answers. Which items are common features of most mammals? produce milk come in all sizes fertilized egg develops inside the body have fins eggs laid outside of body have scales some mammals live in water all have hair or fur​

Answers

Answer: Some mammals live in water all have hair or fur.

Explanation:

Most mammals produce milk, so mammals live in water, all have hair or fur.

4.
What is the importance of biodiversity to humans and to ecosystems?

Answers

Answer:

Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.

Explanation:

looked it up

Shenya Jones, a 34-year-old female, arrives at the office with a swelling and a red pustule on her face. She states the problem started two days ago as a small pimple near her nose. It became irritated then became extremely swollen and painful overnight. This morning there was yellow drainage noted at the site and the swelling has increased. The area of drainage is approximately 1 cm in diameter. The upper lip, side of the face, and nose are all swollen. She rates the pain in her face as a 7 out of 10. The physician thinks the condition may be impetigo or methicillin-resistant Staphylococcus aureus (MRSA), a type of skin infection that is resistant to the common antibiotics used to treat it. A wound culture is obtained.


1. Considering the structures of the skin, what most likely was the cause of the original pimple on this patient's skin?

2. How could Shenya have prevented this skin infection?
Can someone help me please i will pay i have to do this by 12am today no later than that

Answers

1. a sebaceous gland, the types of glands that secrete the oils that keep your skin healthy, likely became a bit clogged and infected. this could have happened for any number of reasons, such as an excess of oil production due to hormones, or buildups of oil due to makeup or improper cleaning.
2. she could have prevented it by not touching the pimple and letting it heal on its own, instead of aggravating the small initial infection. she also could have cleaned her face every morning and night and worn light facial makeup, if any.

The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference

Answers

Answer:

The coefficient of interference, I, is 0.1 (10% expressed as a percent)

Explanation:

Available data:

genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.

The coefficient of interference, I, is complementary with CC.

I = 1 - CC

To calculate the coefficient of coincidence, CC, we must use the next formula:

CC= observed double recombinant frequency/expected double recombinant frequency    

Note:  

observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.

By knowing the positions of genes, we can estimate the distances in MU between them per region.

The  distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MU

Now that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.

recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06

Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:

EDRF = recombination frequency in region I x recombination frequency in region II.

EDRF = 0.13 x 0.06 = 0.0078

Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:

ODRF = number of double crossovers / total number of individuals

ODRF = 7/1000 = 0.007

Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.

CC = ODRF/EDRF

CC =  0.007 / 0.0078

CC = 0.9

And by knowing the CC we can also get the coefficient of interference, I.

I = 1 - CC

I = 1 - 0.9

I = 0.1 = 10% (expressed as a percent)

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

Which type of cell are found in the leaves of a tree?
O eukaryotic animal
O chloroplastic
O prokaryotic
O eukaryotic plant

Answers

Answer:

Palisade parenchyma cells

Explanation:

Palisade parenchyma cells are elogated cells located in many leaves just below the epidermal tissue. Spongy mesophyll cells occur below the one or two layers of palisade cells. Ray parenchyma cells occur in wood rays, the structures that transport materials laterally within a woody stem.

Answer:

eukaryotic plant

Explanation:Unit 2 Test: Cells

O research existing data on accidents involving cars
communicate the results by telling everyone about the prototype
Question 3 (1 point)
There is a set number of times you should go through the engineering design process
- if your design isn't working by the 3rd time through, it's time to just quit and give
up.
True
False
To

Answers

Answer:

false

Explanation:

you fix your design to make it work that is what being is all about if it doesn't work you don't give up you figure out what is wrong and fix it.

Question 9 of 10
Which process is a form of mechanical weathering?

Answers

Explanation:

abrasion, pressure release, thermal expansion and contraction and crystal growth.

NEED HELPP ASAP
Which of these is the best explanation for why the rock on the ocean floor and the rock on the continent are
NOT the same age?
There has been a lot of erosion on the continent and the older rock has been washed away.
There has been a lot of erosion on the ocean floor and the older rock has washed away.
Due to the movement of the plates, the rocks that make up the ocean floor are pulled inside the earth
more often and are much younger.

Answers

Answer:The continental crust is less dense so the oceanic crust subducts back to the mantle. This process explains why the younger rocks are found on the ocean floor. 24.

Explanation:

Which type of wave forms at the boundary between air and water in the open

ocean?


A. Surface

B. Longitudinal

C. Electromagnetic

D. Transverse

Answers

Answer:surface

Explanation:

Just believe me miss gorl

Answer:

surface waves form at the boundary where air and water meet in open ocean.

Explanation:

Just did the quiz.

Help me :(( please. It’s due soon

Answers

The answer is C barriers around mating

Answer:

I would guess B or C

Explanation:

I hope this helps

What are the possible benefits of hybridization?

Answers

Answer: Advantages of hybridization are passing down favorable traits and prolonging the survival of a threatened or endangered species.

Hope this helps! ^^

Answer:

Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.

What is the main purpose of the light reactions?

Answers

Answer:

The overall purpose of the light-dependent reactions is to convert light energy into chemical energy. This chemical energy will be used by the Calvin cycle to fuel the assembly of sugar molecules.

To create ATP and NADPH to be used in the calvin cycle.

Explanation:

Hoped I helped please mark me brainliest!!

1. A dominant gene (A) causes yellow color in rats, the dominant allele on another independent gene (R) produces black coat color. When the two dominants occur together (A_ R_) they interact to produce gray coat color. Rats of the genotype aa are cream-colored. If a gray male and a yellow female, when mated, produce offspring approximately 3/8 of which are yellow, 3/8 gray and 1/8 cream, and 1/8 black, what are the genotypes of the parents

Answers

Answer:

Parents: Yellow (Aarr) and Grey (AaRr)

Explanation:

Given:

allele A = yellow

allele R = black,

Heteroozygous = gray

Genotypes of the parents:

yellow (Aarr) - female

gray (AaRr) - gray

cross between these

Parents: Yellow (Aarr)  and Grey (AaRr)

Gametes: (Ar, ar) and (AR, Ar, aR, ar)

F1 (Punnet square)

----|----- AR ------|------- Ar ------|------ aR -----|----- ar

Ar | AARr (gray) | AArr (yellow) | AaRr (gray) | Aarr (yellow)

ar | AaRr (gray) | Aarr (yellow) | aaRr (black) | aarr (cream)

Ratio: 3/8 yellow : 3/8 gray : 1/8 cream : 1/8 black

blanced diet must contain enough energy to meet the body's needs what else must it contain​

Answers

Answer:

Water

Explanation:

Answer:

A balanced diet should contain many good Factors and they are -It should be very healthy it should be lightit needs to be nutritional The diet should not make the person fatIt should provide better sleep It should keep away the diseases

Hope u like my answer

Which of the following environmental parameters would be important to monitor in order to ensure sustainable logging?

A. The number of trees cut down versus number trees burned
B. The number of new trees planted to replace those removed
C. The number of trees needed to increase soil fertilization
D. The number of trees removed within a single species

Answers

Answer:

B. The number of new trees planted to replace those removed

Explanation:

Because to ensure that logging is sustainable, they have to sustain a certain ratio of trees cut down, to trees planted. D. The muber of trees removed within a single species could be right, but I think B is more right.

If you get this wrong you can blame it on me.

Answer:

The number of new trees planted to replace those removed

Explanation:

Which statement best
summarizes agricultural technology
over time?
A. Agricultural technology has
continually advanced over time, with
significant leaps forward during the
Agricultural Revolution and the Green
Revolution.
B. Agricultural technology
advanced quickly during the
Agricultural Revolution and the Green
Revolution but hasn't advanced since.
C. Agricultural technology didn't
advance before the Green Revolution.
D. Agricultural technology didn't
advance before the Agricultural
Revolution.

Answers

I believe the answer is A!!!!!

Agricultural technology has evolved over time, with significant leaps during the agricultural and green revolutions.

Agricultural revolution

Agriculture has been one of the sustainers (along with hunting) of early men and as such, has seen gradual development with time. Man has always been looking for better ways to do things in order to achieve outcomes.

With the era of the agricultural revolution, there was a huge transition of humans from the primitive lifestyle of hunting and fruit gatherings to that of agricultural settlements. Better ways to carry out crop production started receiving huge attention. from there, hand-made agricultural equipment started surfacing.

The green revolution has agriculture receiving utmost attention in terms of technological innovations. Farm machinery, agrochemicals, etc, started coming up with the result being a massive increase in crop production and general outputs.

More on agricultural revolutions can be found here: https://brainly.com/question/14121608

#SPJ2

All energy comes from the sun. In 2-3 sentences, explain how it is transferred from one organism to another.

Answers

Answer:

When the sun rays come down into the atmosphere and the plants on the ground use photosynthesis to reproduce and eat. If an animal, for example, a bunny, eats grass the energy will be transferred to the bunny. If a fox eats the bunny, the energy transfers to the fox. the amount of energy will be reduced each time something is eaten because it keeps being consumed over and over.

Explanation:

pleaseee help ASAPPP​

Answers

The answer is A
If not then its C

3. How does changing the number of neutrons affect an atom?

Answers

Answer:

The change of number of neutrons does not affect the charge of the atom. All it will affect is your average atomic mass which is the sum of protons and neutrons.

Explanation:  Hope this can help! ^^

Answer:

It will change the isotopes.

On a map, the continents have shapes that almost fit together like pieces of a jigsaw puzzle. How does modern science explain this fit of the matching shapes in terms of processes inside Earth?

Answers

We explain this puzzle-piece-like build as proof of tectonic plate shifting. As magma inside the earth moves, so do the continental plates on top of the magma. The continents used to be fused together in one larger continent called Pangea. Over the course of 1000s of years, the plates have shifted.

tldr: tectonic plate movements cause this phenomena
Other Questions
Many families in California are using backyard structures for home offices, art studios, and hobby areas as well as for additional storage. Suppose that the mean price for a customized wooden, shingled backyard structure is $3,200. Assume that the standard deviation is $1,200. (a) What is the z-score for a backyard structure costing $2,300 People may exercise their right to vote in Washington unless theyO live permanently in another state.O refuse to pay a poll tax.O are unable to work.O were born in another country. Increase or decrease? 35 points ??? Please help Greek drama is not worth studying because it is too old to have any meaning.TrueFalse please give correct answer Whats the prompt for The ground breaking life of Kamala Harris? (I just need one paragraph) #9 Can anyone please help me, this is Pythagoras Theorem Converse. What element is the least reactive: Sior Ba? Jared Harless shattered his elbow in a snowboarding accident and decided to visit a doctor at Smith Union Hospital for treatment. While at the hospital, he interacts with many individuals who attempt to make his experience at the hospital a positive one.In most large organizations, several people are responsible for the buying decisions. These buying center participants can include employees who have a formal role in purchasing decisions (i.e., the purchasing or procurement department), members of the design team for a new product, top managers, and employees who will be using the item being purchased. These employees are likely to play different roles in the buying process. Vendors must understand these roles and adapt the marketing process appropriately for different individuals and for the buying center as a whole.a. Patient b. Vista Insurance c. Shattered Elbow d. Smith Union Hospital e. Elbow-Med Sales Rep f. Materials Manager g. Alternative Treatments h. Specialized Purchase i. Physician j. Surgery k. Price and Success Rete l. Cost-Effectiveness Role player PromptersInitiator User DeciderBuyer Influencer Gatekeeper One number is two times the other, and their sum is 27. What are the numbers? The LaGrange Corporation had the following budgeted sales for the first half of the current year: Cash Sales Credit SalesJanuary $60,000 $160,000February $65,000 $180,000March $50,000 $140,000April $45,000 $130,000May $55,000 $210,000June $90,000 $240,000The company is in the process of preparing a cash budget and must determine the expected cash collections by month. To this end, the following information has been assembled:Collections on sales:45% in month of sale35% in month following sale20% in second month following saleThe accounts receivable balance on January 1 of the current year was $85,000, of which $55,000 represents uncollected December sales and $30,000 represents uncollected November sales.The total cash collected during January by LaGrange Corporation would be:_________ Please help this is due in tomorrow you dont have to answer all questions (7th grade history) Native american groups from which area were first and most affected by this systematic extermination of a natural resource? When humans breed organisms, they are selecting variations that occur naturally in populations.True or false ? 102 - Harder bracketsFind an expression without bracketsfor the area of each rectangle.(x + 3)area =12)Nocalc(-9)Totalarea =121 Florida Palms Country Club adjusts its accounts monthly. Club members pay their annual dues in advance by January 4. The entire amount is initially credited to Unearned Membership Dues. At the end of each month, an appropriate portion of this amount is credited to Membership Dues Earned. Guests of the club normally pay green fees before being allowed on the course. The amounts collected are credited to Green Fee Revenue at the time of receipt. Certain guests, however, are billed for green fees at the end of the month. The following information is available as a source for preparing adjusting entries at December 31.1. Salaries earned by golf course employees that have not yet been recorded or paid amount to $9,600.2. The Tampa University golf team used Florida Palms for a tournament played on December 30 of the current year. At December 31, the $1,800 owed by the team for green fees had not yet been recorded or billed.3. Membership dues earned in December, for collections received in January, amount to $106,000.4. Depreciation of the country club's golf carts is based on an estimated life of 15 years. The carts had originally been purchased for $180,000. The straight-line method is used. Note: The clubhouse building was constructed in 1925 and is fully depreciated.)5. A 12-month bank loan in the amount of $45,000 had been obtained by the country club on November 1. Interest is computed at an annual rate of 8 percent. The entire $45,000, plus all of the interest accrued over the 12-month life of the loan, is due in full on October 31 of the upcoming year. The necessary adjusting entry was made on November 30 to record the first month of accrued interest expense. However, no adjustment has been made to record interest expense accrued in December.6. A one-year property insurance policy had been purchased on March 1. The entire premium of $7,800 was initially recorded as Unexpired Insurance.7. In December, Florida Palms Country Club entered into an agreement to host the annual tournament of the Florida Seniors Golf Association. The country club expects to generate green fees of $4,500 from this event.8. Unrecorded Income Taxes Expense accrued in December amounts to $19,000. This amount will not be paid until January 15.Required:a. For each of the above numbered paragraphs, prepare the necessary adjusting entry (including an explanation). If no adjusting entry is required, explain why.b. Four types of adjusting entries are described at the beginning of the chapter. Using these descriptions, identify the type of each adjusting entry prepared in part a above.c. Although Florida Palms's clubhouse building is fully depreciated, it is in excellent physical condition. Explain how this can be. What region/area was the trading center of the known world in the MiddleAges? The quote below was written at the end of World War II:"Some who suspected that prior reports had been exaggerated . . . felt compelled to admit, 'So it was true!' Others simply exclaimed, 'we didn't' know!'"The quote above refers to what event having to do with the Jewish people? (1 point) herlene has 5.05 in quarters and dimes. The number of quarters is one more than twice the number of dimes. Find the number she has of each kind. help!Why is the following sentence an example of personification? The ocean waves danced along the beach and tickled the sand. help!