Mathematics College

Write equation of a line in point slope form that passes through (3,8) and has a slope of
5?

Answers

Answer 1

Answer:

 y = 5x - 7

Step-by-step explanation:

(3 , 8) ; slope(m) = 5

Equation of the line: y - y₁ = m( x- x₁)

y - 8 = 5(x - 3)

y -8 = 5x - 5*3

y-8 = 5x - 15

   y = 5x - 15 +8

  y = 5x - 7

Related Questions

Im giving Brainlest to who answers the best

Answers

Answer:

oop

Step-by-step explanation:

13 less than the product of a number and 6 is 5

Answers

Answer: Excuse me, what do you mean "and 6 is 5?"

Step-by-step explanation:

please answer this thank you​

Answers

Answer:

x = 0,-1,-2,1,2

y = -3,-5,-7,-1,1

(0,-3)

(-1,-5)

(-2,-7)

(1,-1)

(2,1)

Step-by-step explanation:

y = 2x - 3

x = 0,-1,-2,1,2

y = ?,?,?,?,?

x = 0

y = 2x - 3

y = 2(0) - 3

y = 0 - 3

y = -3

x = -1

y = 2x - 3

y = 2(-1) - 3

y = -2 - 3

y = -5

x = -2

y = 2x - 3

y = 2(-2) - 3

y = -4 - 3

y = -7

x = 1

y = 2x - 3

y = 2(1) - 3

y = 2 - 3

y = -1

x = 2

y = 2x - 3

y = 2(2) - 3

y = 4 - 3

y = 1

Check:

x = 0,-1,-2,1,2

y = -3,-5,-7,-1,1

(0,-3)

(-1,-5)

(-2,-7)

(1,-1)

(2,1)


A cylinder has a radius of 7 meters. Its volume is 3,077.2 cubic
meters. What is the height of the cylinder?

Answers

Answer:

19.99cm

Step-by-step explanation:

[tex]\pi r^{2}h = 3077.2\\[/tex]

plug in 7 for r and you get:

49pi x h = 3077.2

h = 19.99m

8+3(p-9)
Pleaseeee helppp

Answers

Answer:

3p - 19

Step-by-step explanation:

8 + 3(p - 9)

Distribute;

8 + 3p - 27

Collect like terms;

-19 + 3p

3p-19 by using addition and the distributive property

Given the following data, find the weight that represents the 54th percentile. Weights of Newborn Babies 7.78.05.56.76.9 6.19.45.59.37.7 7.66.58.17.16.4

Answers

Answer:

7.35

Step-by-step explanation:

Given the data:

7.78.05.56.76.9 6.19.45.59.37.7 7.66.58.17.16.4

Rearranged data :

5.5, 5.5, 6.1, 6.4, 6.5, 6.7, 6.9, 7.1, 7.6, 7.7, 7.7, 8.0, 8.1, 9.3, 9.4

The 54th percentile :

(54/100) * (n + 1) th term

n = sample size = 15

0.54 * (15 + 1)

0.54 * 16

8.64th term

(8th term + 9th term) / 2

(7.1 + 7.6) / 2

14.7 / 2

= 7.35

Which of the following expressions represents the statement below?

four added to seven times a number

A.
7(n + 4)
B.
4n + 7
C.
4(n + 7)
D.
7n + 4

Answers

Answer:

d

Step-by-step explanation:

7 times a number would be 7n and with addition you can move the numbers around and it won't affect the result.

A crafter is making a triangular flag. She has two sides of length 22 in and 36 in. What are the length possibilities for the third side?

Answers

Answer:

22 in.

Step-by-step explanation:

IN MY BRAIN

the answer is 58^2 because of pythagorean theorem

Jaye walked 50 dogs this week. 40% of the dogs were brown. How many of the dogs were brown?

Answers

Answer: 30

Step-by-step explanation:

50x .4 = 20

50-20=30

40% in decimal form is .04 so to find out the answer you must multiply 50 by .04 which gives you 20. There are 20 brown dogs.

Click on the measure that is equivalent to 3 kilometers!

Answers

Answer:

3000

Step-by-step explanation:

Answer:3000

Step-by-step explanation:

In a 77-kilometer relay race each of 22 team members will run and equal distance how many kilometers will each team run?

Answers

Answer:

3.5km

Step-by-step explanation:

77/22=3.5km each

please mark my answer as brainliest!!!<3

Mrs. Feinstein recorded the weight, in pounds, of each of her 8 great-grandchildren, Her data are shown 45. 52. 31. 27. 38, 60, 44, 55 What is the mean absolute deviation of the data? a 0 pounds b. 9 pounds C 10 pounds d. 44 pounds​

Answers

Answer:

D. 44 pounds

Step-by-step explanation:

I believe this is the answer, I have not done this in a while so let me know how I did :)

What is the measure of an interior angle of a regular 10-gon?

Answers

Answer:

Step-by-step explanation:

can someone make sure my answers are correct

Answers

Answer:

Yes they are all correct. Great job!

Answer:

yep these are correct

Step-by-step explanation:

x2 - 2x + 1 = 0? Please answer fast I need it now

Answers

Answer:

1

Step-by-step explanation:

x2 - x2 = 0

+1 = 1

please help me im pretty stumped

Answers

The awnser is -11 1/2 which is c

-8 - 1 = ?

Please show work for credit/ brainliest

Answers

Answer: The answer is -9

Step-by-step explanation:-8 - 1 = -9

It’s simple ! -8 and your getting smaller ( -1) = -9

What is the difference between the inequality x ≤ 5 and the equation x = 5

Answers

X is smaller or equal to 5. X is 5

A nan brought a cow for $200 and sold it to gain $50. What was his gain as a percentage of the cost price?​

Answers

Answer:

25%

Step-by-step explanation:

Given that,

The cost price of a cow, CP = $200

Gain = $50

We need to find the gain percentage of the cost price.

SP = CP + gain

= 50 + 200

= $250

[tex]\text{Gain}\%=\dfrac{\text{Gain}}{CP}\times 100\\\\=\dfrac{50}{200}\times 100\\\\=25\%[/tex]

So, the gain percent is 25%.

Select the interval where h is positive.
Pleaseee HELP

Answers

b

Step-by-step explanation:

Answer:

2<x<3

Step-by-step explanation:

I did it on khan

A dog is starting a diet to get in better shape. The
dog starts at 89.5 pounds and loses 0.5 pounds
each week for a certain number of weeks. Halfway
through the diet, the dog weighs 80 pounds. How
many weeks has the dog been dieting for?​

Answers

Answer:

18.5 days

Step-by-step explanation:

Count by two's on your fingers until you have nine fingers up, and that equals 9 x 2 = 18, plus that .5 eqauls 18.5 days.

The dog has been dieting for 19 weeks.

What is unitary method?

The unitary method is a technique for solving a problem by first finding the value of a single unit, and then finding the necessary value by multiplying the single unit value.

According to the given problem,

Starting weight of the dog = 89.5 pounds

Halfway weight of the dog = 80 pounds

Weight the dog loses per week = 0.5 pounds

Weight loss = (89.5 - 80) pounds

                    = 9.5 pounds

If the dog loses 0.5 pounds in 1 week,

Then the dog will lose 9.5 pounds in (9.5 × 2) weeks

⇒ The dog will lose 9.5 pounds in 19 weeks.

Hence, we can conclude that the dog has week dieting for 19 weeks and lost 9.5 pounds.

Learn more about unitary method here:

https://brainly.com/question/19423643

#SPJ2

Could someone help with this question brainlest and points

Answers

Answer:

12.99

Step-by-step explanation:

I divided 3 by 0.231, 5 by 0.385, and 10 by 0.77 and got 12.99 for each.

The answer would be 0.770 because this is an example 10 x 0.770 would equal 0.77

An arithmetic sequence is given below. 4, 9, 14, 19, Write an explicit formula for n^th term a v n.​

Answers

Answer:

4 + 5(9) = a

Step-by-step explanation:

4 is the starting term, 5 is the constant term, and 9 is the amount of times you go farther into the sequence, and a is the total number you get

Graph the equation.
y =2x-2

Answers

Answer:

Okay so

y = mx + b

m is the slope

b is the y intercept

Step-by-step explanation:

Step-by-step explanation:

I hope this helps I used desmos

A set of data is summarized by the stem and leaf plot below.

Stem Leaf
1 0 0 2 2 4 5 5 5 6 7 8 8 9 9 9 9
2 0 0 0 3 3 4 5 8 8
3 0 0 1 1 3 4 5 5 5 6 6 6 6 7 7 8 8 8 9 9
4 1 2 2 3 3 3 5 5 6 6 7 8 8 9 9


The value 52 appears _________time(s) in the data set. The value 47 _________appears time(s) in the data set.

Answers

Answer:

0 ; 1

Step-by-step explanation:

Given the dataset :

Stem _____ Leaf

1 _______ 0 0 2 2 4 5 5 5 6 7 8 8 9 9 9 9

2 _______0 0 0 3 3 4 5 8 8

3 _______0 0 1 1 3 4 5 5 5 6 6 6 6 7 7 8 8 8 9 9

4 _______ 1 2 2 3 3 3 5 5 6 6 7 8 8 9 9

The value 52 appears 0 times in the dataset

This is because the stem does not contain the digit 5.

The value 47 appears 1 time(s) in the data set ; stem of 4, leaf 7

I attached the files​

Answers

Answer:

What do u need the help for?

Step-by-step explanation:

You need to make 13 servings of fried fish. Each serving takes 7.5 ounces of flour. How many ounces of flour do you need?

Answers

Answer:

77,5

Step-by-step explanation:

13

. 75

_____

65

71

_____

77,5

What is the difference of the polynomials?

Answers

Answer:

[tex]2x^{3} + 2x[/tex]

Step-by-step explanation:

[tex](x^{4} + x^{3} + x^{2} + x) - (x^{4} - x^{3} + x^{2} - x)[/tex] --> Equation

[tex]x^{4} + x^{3} + x^{2} + x - x^{4} + x^{3} - x^{2} + x[/tex] --> Substituted the -1 on the second parentheses to successfully be able to subtract

[tex](x^{4} - x^{4}) + (x^{3} + x^{3}) + (x^{2} - x^{2}) + (x + x)[/tex] --> Combined Like Terms

[tex](0) + (2x^{3}) + (0) + (2x)[/tex] --> Simplified

[tex]2x^{3} + 2x[/tex] --> Simplified

Hope this helped! <3

x^4 + x^3 + x^2 + x - x^4 + x^3 - x^2 + x

the x^4’s cancel out and so do the x^2’s

2x^3 + 2x

hope this helps

PLEASE ANSWER!!!!!!!!!!!!!!!!!!!

Answers

Answer:

answer attached

Step-by-step explanation:

If you have a 10% off coupon and you buy a 20$ shirt how much you pay with the coupon?

Answers

Answer:

18.00$

Step-by-step explanation:

Answer:

$18.00

Step-by-step explanation:

Thus, a product that normally costs $20 with a 10 percent discount will cost you $18.00, and you saved $2.00.  You can also calculate how much you save by simply moving the period in 10.00 percent two spaces to the left, and then multiply the result by $20 as follows: $20 x .10 = $2.00 savings.  Furthermore, you can get the final price by simply deducting .10 from 1 and multiplying it by $20 as follows: (1 - .10) x $20 = $18.00 final price.

Other Questions
Should geography be harnessed specifically for human gain? The Renaissance begins when Cosimo de Medici and his friends search Europe for ____________. Simply reading pagan authors like Socrates and Plato was punishable by excommunication from the church I need helpn asap , i been on this for the longest When the dry and wet bulb temperatures are far apart. the humidity is high.TrueFalse The angle measurements in the diagram are represented by the following expressions.BSolve for x and then find the measure of Given the following list of numbers, find the mean. 5,6,12,2,5,12,14 here is the CORRECT answer to all you guys answering with semiarid Universal Container wants to understand all of the configuration changes that have been made over the last 6 months. Which tool should an Administrator use to get this information 1. While cell phones provide Freedom and mobility,they can also become a leash, compelling user's to answer them anywhere and anytime How many years will it take for $20,000 to earn $7,000 in interest if placed in an account that earns 2.09% simple interest? I NEED HELP ASAP PLEASERead the poem.Ozymandiasby Percy Bysshe ShelleyI met a traveller from an antique land,Who saidTwo vast and trunkless legs of stoneStand in the desert. . . . Near them, on the sand,Half sunk a shattered visage lies, whose frown,And wrinkled lip, and sneer of cold command,Tell that its sculptor well those passions readWhich yet survive, stamped on these lifeless things,The hand that mocked them, and the heart that fed;And on the pedestal, these words appear:My name is Ozymandias, King of Kings;Look on my Works, ye Mighty, and despair!Nothing beside remains. Round the decayOf that colossal Wreck, boundless and bareThe lone and level sands stretch far away.What is the structure of "Ozymandias"?limericksonnetfree versehaiku Which type of cell are found in the leaves of a tree?O eukaryotic animalO chloroplasticO prokaryoticO eukaryotic plant together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?. Lots of points please help TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids: Given=42and=16, find DG. (help fast please)A. 38.8B.26.4C.44.9D.13.6 Is this statement true or false?Eleanor Roosevelt fought for the rights of the underdog for all those who were persecuted or treated unfairly including women, minorities, the poor, and children. Internal anatomy of the earthworm a. The mouth leads to what structure? b. After the esophagus, food passes through what three structures? c. Undigested particles are eliminated through the what? d. What is the purpose of the nephridium? e. What is the purpose of the seminal vesicles? f. Where are the seminal receptacles located? (repost) Help Please I will Give brainliest If Correct!!