1: What can the reader infer from textual evidence in the last paragraph?
A: All pets with allergies will exhibit irregular behavior.
OB: A check-up will ensure that your pet will remain allergy free.
C: Allergies can affect cats and dogs at any time, and at any age.
D: Humans are more likely to be affected by allergies than animals.

Answers

Answer 1

Answer:

OB: A check-up will ensure that your pet will remain allergy free.

Explanation:

This is true going by the suspicion by the person about the reaction of the pet being due to allergies. In order to resolve this issue, there is need to do a thorough medical check-up on the pet. This would help in the treatment of the allergies leading to it being allergy-free.


Related Questions

Which lines most fully support an interpretation that the speaker feels the nonpoets of the modern world have a misguided perspective?
А
Lines 11-12 ("And make ... door")
B
Lines 14-15 ("To grow...go-getter")
с
Line 24 ("No longer
dreams)
D
Line 33 ("A wordy ... problems")
E
Lines 38-39 ("Grow up
wants")

Answers

Answer:

Explanation:it is D

Answer:

Lines 38-39 (“Grow up . . . wants”)

Explanation:

Correct. The speaker’s advice to “Grow up and join the big, busy crowd / That scrambles for what it thinks it wants” (lines 38-39) follows his advice that “this is no time nor place for a poet” (line 37). By putting the crowd in opposition to poets and saying it “scrambles for what it thinks it wants” (line 39), the speaker implies that the nonpoets are undignified and misguided in their desires.

Given the Old French root plier, meaning “to bend,” which word in bold means “capable of being easily influenced”?

The jury members were insulted by the suggestion that they were pliable.

It was not plausible that the vase broke by itself.

The park was overrun by a plethora of pigeons.

The shirt was quite difficult to iron because it was pleated.

Answers

Answer:

The jury members were insulted by the suggestion that they were pliable.

Explanation:

According to the excerpt given, from the old French root word "plier" which means "to bend", the word that means “capable of being easily influenced” is option A, The jury members were insulted by the suggestion that they were pliable.

This is because, the word "pliable" is from the root word "plier" which means that the members of the jury were insulted because it was suggested that they were capable of being easily influenced.

What’s is a cultural diversity? In your own words

Answers

Answer:

different culture of difference ppl all different shapes in sizes and different skins color the key point is (different)

Answer:

In my own words cultural diversity is the what makes the world an interesting and diverse place with diverse and interesting people.

Explanation:

Which sentence uses correct punctuation?
O A. I bought flour butter, and salt: just the essentials.
B. I bought flour, butter, and salt just the essentials
c. I bought flour butter, and salt just the essentials
D. I bought flour, butter, and salt just the essentials.

Answers

Answer:D

Explanation:

Answer:

D

Explanation:

help asap. will mark brainliest

Part A

What inference can be made about Lenore in "The Raven" by Edgar Allan Poe?

A. Lenore has moved far away.

B. Lenore will return home soon.

C. Lenore married someone else.

D. Lenore has died.

Part B

Which evidence from the text best supports the answer in Part A?

A. "This I whispered, and an echo murmured back the word, 'Lenore!"

B. "It shall clasp a sainted maiden whom the angels name Lenore_-"

C. "Respite respite and nepenthe from thy memories of Lenore"

D. "And the only word there spoken was the whispered word, 'Lenore!'"

Answers

Answer: Part A: D is the answer.

              Part B: B is the answer

Explanation:

the other girl made a simple mistake. I took the test, The answers are in fact D and B. Have a nice day :D

Answer: The answer is D. Lenore has died. For Part B the answer is, "It shall clasp a sainted maiden whom  the angels name Lenore."

Explanation: I had just taken the Quiz.

how does banquo react to the attack

Answers

Answer:

i think he laughs i don't know im pretty sure im right tho

that is a heavy box​

Answers

Answer:

ok?..................

Answer:

ok??

Explanation:

6.
What is the meaning of "flippant" as it is used in paragraph 30?
A. benevolent
B. frivolous
C. callous
D. defiant

Answers

frivolous

hope this helps !!

Answer:

frivolous

Explanation:

Part B
Select two stanzas from Passage 2 that support your response to Part A.

A. "At winter's close, my heart was cold, Frozen like the great outdoor. Boredom kept out all the warmth; I found no fun in school or chores."

B. Mrs. Grady lived next door, Her garden withering away. She could not do the work alone. Her hands were shaking more each day."
C. "And so I worked-by her side- Churning up the rich, black earth, Raking, weeding, composting Preparing ground for springtime birth." V
D. "In furrows etched into the ground, Sprinkled seeds sunk into place; Veggie plants soon found their homes, Growing each in their own space."
E. "To make new friends, try new things; Put yourself out there, join a team, Improve your mind, stretch your wings, And don't you dare forget to dream."​

Answers

Answer:

a and d

Explanation:

finish this

what is love? ... baby

Answers

Answer:

don’t hurt me

Explanation:

you are attempting to convince an audience that animal testing is morally wrong

Answers

To convince give them reasons, The harm that is committed against animals should not be minimized because they are not considered to be "human." In conclusion, animal testing should be eliminated because it violates animals' rights, it causes pain and suffering to the experimental animals, and other means of testing product toxicity are available.

According to the narrator of a visit to Europe, which belief did British hold about Indian women?

Answers

Answer:

Indian women are mistreated by their husbands.

Explanation:

Answer: Indian women are mistreated by their husbands.

Which of the following is a denotation of interesting?
O A. Emotions of excitement
B. Overwhelming feeling
O C. Holding one's attention or provoking interest
O D. Memories of science class experiments

Answers

Answer:

c

Explanation:

it makes the most sense

It's common for eyewitnesses to

a report contradictory versions of the events that they saw.

b Remember minute details perfectly for many years after the event

c come to news bloggers to help make sense of what they sem

d form the same opinion as each other about what they ve
witnessed

Answers

The answer to your question is letter “ D “

Drag each tile to the correct box. Read the excerpt from Nathaniel Hawthorne's "Dr. Heidegger's Experiment," and then match the characters with the traits they represent. Colonel Killigrew lust Mr. Medbourne pompousness Widow Wycherly vanity Mr. Gascoigne greed arrowBoth arrowBoth arrowBoth arrowBoth Reset Next

Answers

Answer:

Mr. Gascoigne = Pompousness

Widow Wycherly = Vanity

Mr. Medbourne = Greed

Colonel Killgrew = Lust

Explanation:

Answer:

i took the test.

Explanation:

Does the VERB agree with the SUBJECT in this sentence?
My friends have given me good advice.
A.
Yes
B.
No

Answers

Answer:

A. Yes

Explanation:

Since the subject of this sentence is plural, that means the verb must fit with a plural subject. In this sentence, "have given" is the correct term to go with the plural "my friends." If the subject was singular, the sentence would read, "My friend has given me good advice." However, since "my friends" is plural, "has given" would be incorrect. The sentence is correct in using "have given."

Answer:

Yes

Explanation:

Negative thoughts/feelings​

Answers

Answer:

Hello Queen Messy here!

. Lonely

. Getting bullied

. having no friends

. no one cares about you.

and more  (:

Explanation:

Answer:

Negative thoughts?

Explanation:

I'm scared that ill fail the 6th grade

im a nobody

I dont like my self

My sisters make me not want to have kids

I really just dont like myself

Stuff like that is negative.

Why journals don’t seek replication studies

Answers

Answer:

journals have developed a response procedure that casts doubt on the replication study authors first, before any questions are asked of the original authors.

Explanation:

Read the excerpt from midsummer by derek walcott Praise had blee my lines white of any more anger, and snow had inducted me into white fellowships, while Calibans howled down the barred streets of an empire Based on the allusion to Calibans, readers can infer that
the speaker
Obelieves most British people are prone to violence.
feels that the rioters are different than this
Shakespearean character.
Obelieves that the current anger in Brixton is justified.
feels that the rioters are similar to this
Shakespearean character.

Answers

Answer:

feels that the rioters are similar to this Shakespearean character.

Explanation:

I did the quiz

Based on the allusion to Calibans, readers can infer that the speaker feels that the rioters are similar to this Shakespearean character.

What is Allusion?

This is a figure of speech which talks about the person or character who is not present as if he were present without doing it overtly.

With this in mind, we can see that from the given narration, there is the use of allusion to show that there is the deduction that the speaker feels that the rioters are similar to this Shakespearean character.

Read more about allusion here:

https://brainly.com/question/2427003

Use the word homogenize in a sentence.

Answers

The two liquids homogenized in the blender.

Answer: you must homogenize milk before you consume it.

Explanation:

Which of these words would be used to refer to a young child's walk when
she is first learning how to walk?
O A. Tottering
B. Striding
O C. March
O D. Limping

Answers

Tottering means stumbling/ having issues ofc a baby would be stumbling

Answer:

A. Tottering

Explanation:

I believe it is answer choice A because tottering means someone is walking in a weak and unstable way which would be an effective word to describe a young child's walking.

It is not C or B because those choices imply that the person is walking confidently and is strong in their movements. Answer choice D would not work either because someone usually only limps when injured.

Anyone know the answer

Answers

Answer:

c

Explanation:

i took the test

economics
civics
culture
geography
artifacts
Put each word into a sentence to show your understanding of the word

Answers

Answer:

Culture is the sum total of the beliefs and way of life of a particular set of people.

Smart economics is a very important factor in any country that wants to be prosperous and make the cost of living for her citizens affordable should imbibe.

The geography of a place includes the physical characteristics and atmosphere of a particular place.

Archaeologists on the site found some articitacts from the pre-historic era.

Civics is the study of the rights, duties and obligations of a citizen.

Schools must ensure certain rights, accommodations
and protective measures for sexual assault victims
only if they choose to report to law enforcement.

True
False

Answers

Answer: False

Explanation:

Sexual violence and harassment are vices which typically occurs in schools. It is important that in every school, there should be a procedure or sector that will be in charge of handling the complaints by victims of sexual related vices.

With regards to the question, schools must ensure certain rights, accommodations and also protective measures for sexual assault victims not only in a situation whereby they choose to report to law enforcement.

What should happen next in my story after this?
Seth’s POV:

I’m really not sure why I invited her here. Was it because of the bet or did I actually what to hang out with her? Was it just because my parents were arguing again and I needed to get out? What the heck.. of course it’s because of the bet and maybe because I wanted to get away from my parents. She is not fun and super rude. I’d never want to hang out with her on my own. This is definitely for the bet. All that laughter and ‘fun’ was totally fake. She’s still an annoying spoiled brat.. right? I really don’t know how to see her anymore because right now she looks really adorable feeding the ducks. She has a big smile on her face and she generally looks really happy. Happy suits her. What am I even saying? This is kinda bad, I’m actually having... fun. I even almost told her about my parents fighting.. she definitely can not know about that. She wouldn’t understand. While I’m deep in thought, I notice her dump the rest of the bag of bread crumbs in the pond and giggle. I like when she laughs. Wait, no I don’t. “Pretty boy! Dump the rest of your crumbs to the ducks!” I smile and do as she says. “My name is Seth. You can stop calling me pretty boy.” She looks at me with a grin and says, “You know, I think I like pretty boy better.” She laughs and I glare at her. That’s what I said to her earlier when Ava told me her name. “Well, I guess I am pretty.” I say in a confident tone. She looks at me and responds, “Not even close.” I glare at her some more. She’s definitely still mean and bratty. “Aww, did I make you mad?” She asks in a mocking tone. Of course she did but I’m not admitting that to her. I walk towards her and she stops laughing and asks, “What are you doing?” I grin at her secretly knowing that she’s going to hate me even more after I do this. I walk even closer and push her into the pond. She screams and she hits the water and is completely soaked. “Oh my gosh! What is wrong with you?! I hate you!” She screams at me but I’m too busy laughing to pay attention. The next thing I know, I’m in the pond too. She grabbed my leg and pulled me in. I should have seen that coming. Now she’s dying of laughter. “I can’t believe you just did that!” I say to her. She starts laughing again and through her laughter says, “Oh come on! You totally deserved that!” I smile and say, “I guess I did.” She giggles. That annoyingly adorable laugh she has is driving me crazy. “We should go, it’s getting late.” I say to her. “Yeah, probably.” She replies. We crawl out of the pond and we are drenched. “We are really wet, won’t your parents get mad if you ruin the car?” How does she know my parents still come to my place? Does she know about my family issues? Did she hear them fighting through the phone call? “Why are you talking about my parents? That’s none of your business and if you must know, the car is mine.” I snap at her. I hear her mumble, “And you call me a brat.” “Whatever, get in the car sunflower.” The wetness won’t bother my car, after all, it’s just water. It will dry. The whole way back to sunflower’s place is pretty quiet. None of us say a word. Finally, I pull up to her house and park the car. She gets out and I say, “I guess I’ll see you tomorrow sunflower.” “Yeah, see ya pretty boy.” She closes the car door and I watch her as she walks into her apartment.


What should happen next in this chapter? (Btw, Seth is the main guy in the story and Sila is the main girl. Seth made a bet on Sila to make her like him. They also do not get along at all)

Answers

Answer:

I think that they should arrive at the house and then they should have a conversation, you should include humor and towards the end of the conversation you can include Seth saying that he likes her and she says the same. She should then explain that that is why she calls him pretty boy and she always acts snooping around him and you should end it with Seth winning the bet but giving back whatever was given to him for the bet because he and sila are now in love.

Explanation:

I know that sounded so corny but that is just what came to my mind, I love your story and would love to read more stories if you write anymore! Keep up the good work!

Read the poem.

Ozymandias

by Percy Bysshe Shelley

I met a traveller from an antique land,
Who said—“Two vast and trunkless legs of stone
Stand in the desert. . . . Near them, on the sand,
Half sunk a shattered visage lies, whose frown,
And wrinkled lip, and sneer of cold command,
Tell that its sculptor well those passions read
Which yet survive, stamped on these lifeless things,
The hand that mocked them, and the heart that fed;
And on the pedestal, these words appear:
My name is Ozymandias, King of Kings;
Look on my Works, ye Mighty, and despair!
Nothing beside remains. Round the decay
Of that colossal Wreck, boundless and bare
The lone and level sands stretch far away.”



What is the structure of "Ozymandias"?

sonnet

haiku

free verse

limerick

Answers

the poem above is a sonnet

Free verse because there doesn’t appear to be a set rhyme structure

Dr. Cunningham, a highly respected professor of anthropology, studies famous historical
documents.

Answers

That is very cool. There’s no question to answer here but still cool.

HELP LIKE RN PLEASE!
The author of Passage 1 makes the claim that animal testing is necessary. Which ONE sentence below from Passage 2 BEST refutes this claim?


A“Microdosing means human subjects are given doses that are too small to cause a full-scale adverse reaction, and their blood is then simply analyzed for data.”
B“For example, a DNA synthesis test on an animal costs over $30,000, while the same test on human cells in a beaker costs about $10,000.”
C“Likewise, medications successfully tested on animals could kill humans immediately when going to market.”
D“For perspective, over 25 million animals are completely unprotected from abuse and mistreatment every year.”

Answers

Answer:

Answer is A

Explanation:

56:40
Read Shakespeare's "Sonnet 130."
What evidence supports the serious nature of the
sonnet? Select two options.
Albel
"My mistress' eyes are nothing like the sun
'If hairs be wires, black wires grow on her head."
"I have seen roses damask d, red and white
My mistress' eyes are nothing like the sun,
Coral is far more red, than her lips red:
If snow be white, why then her breasts are dun,
If hairs be wires, black wires grow on her head.
I have seen roses damask'd, red and white,
But no such roses see I in her cheeks,
And in some perfumes is there more delight
Than in the breath that from my mistress reeks.
I love to hear her speak, yet well I know
That music hath a far more pleasing sound:
I grant I never saw a goddess go,-
My mistress, when she walks, treads on the ground:
And yet by heaven, I think my love as rare,
As any she belied with false compare.
"I love to hear her speak
"And yet by heaven, I think my love as rare

Answers

Answer:

"I love to hear her speak ''"And yet by heaven, I think my love as rare

Explanation:

The speaker in this sonnet acknowledges that his mistress does not have heavenly qualities that make her overly attractive but he still has a rare love for her that enables him to love hearing her speak even though music has a more pleasing sound.

This shows that the sonnet is of a serious tone with the speaker truly loving his mistress regardless of qualities that she possesses which he does not believe are attractive.

Can someone give me an original example of a persuasive essay with 5 paragraphs with just 200 words?

Answers

Answer: Have you ever came home on a tiring day,  then realising that there’s homework to do?! I’m sure, many have experienced this. I stand firmly in my opinion that teachers shouldn’t give homework, I intend to discuss why.

Firstly, enough information is discussed in class; we cannot remember everything. Piling students up with homework can make what has been taught forgotten, or worse, making them lose their willingness to learn. You can’t expect us to remember everything you have taught us!

Secondly, homework takes up lots of physical engagement time. When you do homework, you’re on a chair; sitting too long can cause pains. Furthermore, it can cause diseases that wouldn’t happen if we have time to move around.

Furthermore, it stresses students out and can cause mental health issues. They can affect our whole life immensely! Stuff like focusing, thinking or anything, you name it! I’m sure that you don’t want to have these issues; students don’t as well.

My statement won’t be swayed, homework should not be given to children. It can cause problems along the way, problems that teacher’s themselves could despise as well. If they tried to be in our shoes, they will certainly know why.

Exactly 200 words! Hope it helps <3

Other Questions
1. While cell phones provide Freedom and mobility,they can also become a leash, compelling user's to answer them anywhere and anytime How many years will it take for $20,000 to earn $7,000 in interest if placed in an account that earns 2.09% simple interest? I NEED HELP ASAP PLEASERead the poem.Ozymandiasby Percy Bysshe ShelleyI met a traveller from an antique land,Who saidTwo vast and trunkless legs of stoneStand in the desert. . . . Near them, on the sand,Half sunk a shattered visage lies, whose frown,And wrinkled lip, and sneer of cold command,Tell that its sculptor well those passions readWhich yet survive, stamped on these lifeless things,The hand that mocked them, and the heart that fed;And on the pedestal, these words appear:My name is Ozymandias, King of Kings;Look on my Works, ye Mighty, and despair!Nothing beside remains. Round the decayOf that colossal Wreck, boundless and bareThe lone and level sands stretch far away.What is the structure of "Ozymandias"?limericksonnetfree versehaiku Which type of cell are found in the leaves of a tree?O eukaryotic animalO chloroplasticO prokaryoticO eukaryotic plant together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?. Lots of points please help TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids: Given=42and=16, find DG. (help fast please)A. 38.8B.26.4C.44.9D.13.6 Is this statement true or false?Eleanor Roosevelt fought for the rights of the underdog for all those who were persecuted or treated unfairly including women, minorities, the poor, and children. Internal anatomy of the earthworm a. The mouth leads to what structure? b. After the esophagus, food passes through what three structures? c. Undigested particles are eliminated through the what? d. What is the purpose of the nephridium? e. What is the purpose of the seminal vesicles? f. Where are the seminal receptacles located? (repost) Help Please I will Give brainliest If Correct!! Write the equation of the line passing through the points (-7,4) and (7,2). Mia is a songwriter who collects royalties on her songs whenever they are played in a commercial or a movie. Mia will earn $50 every time one of her songs is played in a commercial and she will earn $120 every time one of her songs is played in a movie. How much would Mia earn if his songs were played in 5 commercials and 3 movies? How much would Mia earn if his songs were played in cc commercials and mm movies? Which statement best describes subduction? Can yall help please Factor the expression.2x + 8 Angela works 18 hours a week for 12 weeks in the summer at the local swimming pool as a life guard. She earns $13 per hour. Her employer takes 15 percent out of her check for federal income tax withholding and 6.2 percent for Social Security and 1.45 percent for Medicare. She will receive 12 paychecks, one for each week she works. Calculate Angelasweekly gross pay A line passes through the point (-10, -6) and has a slope of 1/2. Write an equation in slope-intercept form for this line. write an equation illustrating the condensation of p-diaminobenzene with the acid chloride of oxalic acid (cocl)2