Alright people..guess the lyrics if u don't get it right your not an arianator :)

"Somethin' 'bout you makes me feel like a dangerous woman"

Answers

Answer 1
something bout, something bout you, makes me wanna do things that i shouldnt
Answer 2

Don't need permission

Made my decision to test my limits

Cause it's my business, God as my witness

Start what I finished

Don't need no hold up

Taking control of this kind of moment

I'm locked and loaded

Completely focused, my mind is open

All that you got, skin to skin, oh my God

Don't ya stop, boy

Somethin' 'bout you makes me feel like a dangerous woman

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

Makes me wanna do things that I shouldn't

Somethin' 'bout, somethin' 'bout, somethin' 'bout

Nothing to prove and I'm bulletproof and

Know what I'm doing

The way we're movin' like introducing

Us to a new thing

I wanna savor, save it for later

The taste of flavor, cause I'm a taker

Cause I'm a giver, it's only nature

I live for danger

All that you got, skin to skin, oh my God

Don't ya stop, boy

Somethin' 'bout you makes me feel like a dangerous woman

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

Makes me wanna do things that I shouldn't

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

All girls wanna be like that

Bad girls underneath, like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

All girls wanna be like that

Bad girls underneath, like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

Somethin' 'bout you makes me feel like a dangerous woman

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

Makes me wanna do things that I shouldn't

Somethin' 'bout, somethin' 'bout, somethin' 'bout you

All girls wanna be like that

Bad girls underneath like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

All girls wanna be like that

Bad girls underneath like that

You know how I'm feeling inside

Somethin' 'bout, somethin' 'bout

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

(Somethin' 'bout, somethin' 'bout, somethin' 'bout you)

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

Yeah, there's somethin' 'bout you boy

(Somethin' 'bout, somethin' 'bout, somethin' 'bout you)


Related Questions

Can u help me please

Answers

I'll help

The sum of the prices for the items(That's 2large baskets and small gift baskets) for the first customer is $57. So assuming the price of a large basket is x and small basket is y, then an expression for the first sentence is;

2x + 5y= 57

The sum of the prices for the second customer is $6 less than the first customer ( that's 57-6 which is $51). Since he bought 1 large basket and 10 small baskets and the price of each large basket is the same and the price of each small basket is the same they assume the same variable of x and y. So the expression of the second sentence is;

x+10y=51.

So the expressions will be;

2x+5y=57

x+10y=51

That's Option C

help pleaseee I really need this done​

Answers

Angle 1 is 115 and angle 2 is 65.

Find the angle with the smallest measure in △ VUW. Name the angle using three letters

Answers

Answer:

∠VUW

Step-by-step explanation:

A triangle is a three sided polygon with three angles. Types of triangles are obtuse, scalene, isosceles, equilateral and so on.

In triangle VUW, since VU = WU, hence it is an isosceles triangle. In an isosceles triangle, two sides of the triangle are equal.

The size of an angle depends on its opposite side, the higher the opposite side the higher the angle. Since In triangle VUW, VU = 9, WU = 9, VW = 5. Since VW is the smallest side, the angle opposite to VW is the smallest angle.

Hence the smallest angle = ∠VUW

Simplify the expression so there is only one positive power for each base. ​

Answers

i hope you understand

Solve for x, using the exterior angle theorem.

Answers

Answer:

x=121 degrees

Step-by-step explanation:

The extetior angle theorem states that one exterior angle is equivalent to the sum of the opposite two interior angles. So, we can say that x is the sum of the opposite two interior angles, (53 and 68), and 53+68=121.

Sheila's entertainment center has enough space for a television that is 12 inches long and 15 inches high. TVs for Less is selling a television with an area of 196 square inches. Will the television fit in Sheila's entertainment center?

Answers

12x15 = 180

196 is greater than 180

No, the tv will not fit

What is Newton's Second Law in VERY simple terms??? I don't really understand!!!

Answers

Answer: so basically newtons law states that unless something puts force against a moving object to stop it the object will continue moving. And unless you put force on a still object it will continue to not be in motion

Step-by-step explanation:

A copy machine makes 36 copies per minute. How long does it take to make 126 copies?

Answers

Answer:

It will take 3.5 minutes to make 126 copies

Step-by-step explanation:

Answer:

Step-by-step explanation:

We can do 126/36 to get our answer since 126 is the total copies and 36 is the copies we can do in a minute. 126/36 = 3.5 so it will take 3.5 minutes.

Evaluate -x + 8 for x = 5.​

Answers

Answer:

3 is the answer

Step-by-step explanation:

-(5)+8

-5+8=3

you just change x for 5  and go from there

PLEASE MARK BRAINLIEST!

In this problem, you have to use substitution!

-x + 8, when x = 5

1) Substitute the value of 'x' with '5'

   -x + 8

= -5 + 8

2) Reverse the expression to make it easier to solve [optional]

  -5 + 8

= 8 - 5

3) Solve!

   8 - 5

= 3

Your answer is 3

I hope this helps!

- sincerelynini

A square has an area of 72 square inches. What is the side length?

Answers

Answer:

8.5

Step-by-step explanation:

:)

PLEASE HELP!! GIVING BRAINLIST TO WHOEVER ANSWERS

Answers

Does represent , like dividing or multiplying by 2

HELPPPPPPPPPPPPPPPPPP

Answers

Answer:

The answer to this d=0.6t because evry minute it is .6

WILL GIVE FAST BRAINLIEST
3(2x^4y^6)^5 / (3x^6y^3)^4
Fraction btw show work or no brainly

Answers

Answer:

32y^18/27x^4

Step-by-step explanation:

I factored the numerator and denominator and canceled the common factors

Here is the answer, glad I could help.
Also, can you mark me as the brainliest answer?
Thanks.

What is the vertex of the function defined as
g(x) = f(x – 5) + 3?

Answers

Answer:

f=gx−3/x−5

Step-by-step explanation:

Step 1: Flip the equation.

fx−5f+3=gx

Step 2: Add -3 to both sides.

fx−5f+3+−3=gx+−3

fx−5f=gx−3

Step 3: Factor out variable f.

f(x−5)=gx−3

Step 4: Divide both sides by x-5.

f(x−5)/x−5=gx−3/x−5

Which of the following functions is graphed below?

A. Y=[x] -7
B. y=[x] +7
C. y=[x] +5
D. y=[x] -5

Answers

The correct answer is B

simplify the expression so there is only one positive power for the base, -5.​

Answers

Answer: The answer is C

Answer:

the anwer is c ig

Step-by-step explanation:

A triangle with vertices D, E, and F are plotted on the coordinate plane at (0, 5). (2, 0), and (-4, 2), respectively. When constructed,
medians DG and EH intersect at the point with which coordinates? Round each coordinate to the nearest tenth if necessary.


A. (-0.7, 2.5)

B. (-1, 1)

C. (-0.7, 2.3)

D. (-2, 3.5)

Answers

Given:

Vertices of a triangle are D(0,5), E(2,0) and F(-4,2).

To find:

The intersection point of medians DG and EH.

Solution:

We know that, intersection point of all the medians of a triangle is called centroid.

The formula of centroid is

[tex]Centroid=\left(\dfrac{x_1+x_2+x_3}{3},\dfrac{y_1+y_2+y_3}{3}\right)[/tex]

Vertices of a triangle are D(0,5), E(2,0) and F(-4,2). So, the centroid of the triangle is

[tex]Centroid=\left(\dfrac{0+2+(-4)}{3},\dfrac{5+0+2}{3}\right)[/tex]

[tex]Centroid=\left(\dfrac{-2}{3},\dfrac{7}{3}\right)[/tex]

[tex]Centroid=\left(-0.666...,2.333\right)[/tex]

Round each coordinate to the nearest tenth.

[tex]Centroid=\left(-0.7,2.3\right)[/tex]

Therefore, the correct option is C.

What is the absolute value of -3?
A. -3
B. 3

Answers

Answer:

B. 3

Step-by-step explanation:

[tex]|a|=\left\{\begin{array}{ccc}a&if&a\geq0\\-a&if&a<0\end{array}\right[/tex]

Examples:

[tex]|3|=3\ because\ 3\geq0\\\\|-10|=-(-10)=10\ because\ -10<-\\\\|0|=0\ because\ 0\geq0\\\\|-0.5|=-(-0.5)=0.5\ because\ -0.5<0\\\\|-1,000|=1,000\ because\ -1,000<0[/tex]

Your question:

[tex]|-3|=-(-3)=3\\\\|-3|=3[/tex]

which point on the number line represents -1 1/3?​

Answers

Answer:

C. point R

Step-by-step explanation:

Terry made 7 chicken pot pies during the month of October. He baked each pie individually for 18 minutes at one temperature. Then he baked each pie for another 20 minutes at a lower temperature. About how many minutes did Terry spend baking chicken pot pies in October?
Group of answer choices

Answers

Answer:

he spent 166 minutes baking pot pies in October

Plz help I’ll appreciate it plz help

Answers

Answer:

x = 36

Step-by-step explanation:

Here, we want to get the value of x

As we can see on the markings, the base angle are equal

Thus, the other base angle is x too

mathematically, the sum of all the interior angles of a triangle = 180

thus;

3x + x + x = 180

5x = 180

x = 180/5

x = 36

If you were serving pumpkin pie at your Thanksgiving dinner, how much pie would 8 guests receive? What about 4 guests? 2 guests?

Answers

Answer:

Step-by-step explanation:

if you serve all the pie to 8 guests.. then they would each get 1/8.. if you were able to cut it exactly the same.. but..  we all know that there is always one piece that is bigger and we all want that piece  :P  b/c pumpkin pie is good

1/8

1/4

1/2

respectively for each of the questions

Sin (2x-17)° =(x-4)°

Answers

Answer:

2x-x-17=-4

2x-x=-4+17

x=-4+17

x=13

Step-by-step explanation:

(PLEASE HELP 50 POINTS) At a dog show, the entries included Welsh corgis and cocker spaniels. The table compares the weights within this sample of dogs.
Answer the questions to compare the weights of the dog breeds and determine which breed of dog had the heaviest entry.

1. What is the median weight of the Welsh corgis? What does the median tell you about their weights?

Write your answer in the space below.







2. Which type of dog has the greater variation in weights? Justify your answer.

Write your answer in the space below.



3. Do you think the heaviest dog in the show was a Welsh corgi or a cocker spaniel? Explain how you made your choice.

Write your answer in the space below.

Answers

Answer:

1. 27

Im not sure about 2 but i think its welsh corgis

3. (Im also not sure about this one, so dont take my word for it if my answer doesnt seem right) I think the heaviest dog is the welsh corgi bc i added all the weights together for the welsh corgis.

Step-by-step explanation:

According to the table the median of Welsh Corgi is 27.3kg whereas the Welsh Corgi has the maximum variation in weights.

What is the median?

The median is the center most value of the data.

What is mean absolute deviation?

It is the distance of value from the average mean.

How to answer?

1) When we see table we can easily find that the median of Welsh Corgi is 27.3 kg and median tells us about the center level of all the weights.

2)Welsh Corgi has the greater variation in weights because its range is higher than Cocker Spaniel.

3) No, because average weight of both the type of dogs is equal.

Learn more about statistics at https://brainly.com/question/15525560

#SPJ2

solve the system of linear equations 2x + 3y =16.9
5x =y + 7.4

Answers

Answer:

y = 23.4

Step-by-step explanation:

yeahhhh

Hey! I need some help with this question I'm not very good with math so if anyone would be willing to help me out id be grateful thx.
An asteroid is 10^{8} miles away from earth, and it is traveling at a speed of 10^{5} miles per day.

How many days will it take the comet to reach earth?

Answers

Answer:

It will take 10^3 days for the comet to reach earth.

Step-by-step explanation:

10^8 = 100,000,000

10^5 = 100,000

100,000,000/100,000 = 1,000

1,000 is equal to 10^3

how do you find out the rate per hour using minutes

Answers

Answer: You do this by dividing the minutes worked by 60. You then have the hours and minutes in numerical form, which you can multiply by the wage rate

Step-by-step explanation:

Answer:

You do this by dividing the minutes worked by 60. You then have the hours and minutes in numerical form, which you can multiply by the wage rate. For example, if your employee works 38 hours and 27 minutes this week, you divide 27 by 60.

Step-by-step explanation:

a quadrilateral has 2 angles that measure 100 and 60 degrees the other angles have a ratio of 3:17 . what are the measures of those angles?

Answers

Answer:

30° , 170°

Step-by-step explanation:

Let the remaining two angles be 3x & 17x. As it is a quadrilateral , the sum of all the angles of quadrilateral is 360°. So,

[tex]3x + 17x + 60 + 100 = 360[/tex]

[tex] = > 20x + 160 = 360[/tex]

[tex] = > 20x = 360 - 160 = 200[/tex]

[tex] = > x = \frac{200}{20} = 10[/tex]

Putting the value of x , remaining angles are

(3×10 = 30°) & (17×10 = 170°)

Answer:30° and 170°

Step-by-step explanation:

the missing angles 3:173x+17x+60+100=360°20x+160=360°20x=360-16020x=200°divide both sides by 20X=10substitute X=10 in 3x and 17x3(10)=30°17(10)=170°

The postal service offers flat-rate shipping for priority mail in special boxes. Today, Duncan shipped 10 small boxes and 9 medium boxes, which cost him $149 to ship. Meanwhile, Hannah shipped 7 small boxes and 1 medium box, and paid $46. How much does it cost to ship these two sizes of box?

Answers

Answer:

298

Step-by-step explanation:

844677$bubjnuncidnxisbixbsixnisnxisbfibeufbrinfuenfudbucnrucbeibfe

please help I need you​

Answers

Answer:

The answer is B.

Step-by-step explanation:

Diameter x Pi = Circumference

8 x 3.14 = 25.12

Answer:

B

Step-by-step explanation:

Other Questions
What types of individuals can be rejected from your school without using a specific name campus? Why? Do you think this is fair? Why or why not? Caitlin earns $7.00 an hour doing yard work for her neighbor. She worked 3 hours Friday, 4 hours Saturday, and more hours Sunday. She earned $77.00 for the weekend. How many hours did she do yard work on Sunday? ASAP NOW AND YOULL GET 20 and ILL ANSWER ONE OF URS Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) BRAINLYEST According to the narrator of a visit to Europe, which belief did British hold about Indian women? The nth term of a sequence is n-4a) Work out the first three terms of the sequence.b) Work out the tenth term of the sequence. do you guts want to play never have I ever?? helsea is graphing the function f(x) = 20(One-fourth)x. She begins by plotting the initial value. Which graph represents her first step? On a coordinate plane, the point (0, 0.25) is graphed. On a coordinate plane, the point (0.25, 0) is graphed. On a coordinate plane, the point (0, 20) is graphed. On a coordinate plane, the point (20, 0) is graphed. Write the equation of the line that passes through points (-4, 5) and (0,13) in slope-intercept form. You have been saving money for something that you have wanted for a long time. Finally, you havebeen able to buy it.Write an email to a friend about your experience.In your email, you should:say what you wanted to buy and why.explain how you managed to get the money you neededdescribe how you feel now that you have got what you Your email should be between 150 and 200 words long. 22=????? Hurryppls help hurryy6yyyyyyyyyyyy6yyyyyyyy6yyyyy what is the volume of a cylinder with a a radius of 9 inches and a hirght of 2 inches? use 3.24 for pie. round your answer to the nearest hundredth 1. Use each of these terms in a sentence that explains the term's meaning. a. gross national product b. productivity c. recession During the Elizabethan period, relations between England and Spain were tense, describe the results of that friction 2x + 7 = 19 X=?Which one is the answer The general area of the atom (outside the nucleus) where the e- are located is the and What is the value of n?2n 1 = 5 What biotic factors might affect a population of fish? Check ALL that apply. predatorspreylightbacteria Based on the table, which function represents the same relationship? The x column has 0, 1, 2, 3. The y column has 0.0625, 0.25, 1, and 4.AnswerA g(x) = (0.25)B g(x) = 256(0.25)C92) = 0.0625(4)"D g(x) = 0.5(4)"